Rh5AG344200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0001141
Physical Location & Seq
Forward (+)
56555051 .. 56561503
6453 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG344200.1

Sequence Viewer

Length: 219 bp
ATGAAAACAAGAGCAGAAAACAAAACGGAATTAAGTGTGAAGAAAGTGATTGTGAGAAAAATTAGAGGAAAACAGAAAAGAGGTTGTCGAGGTCTCTCGATCGGCTCTGTTAGGGAGTTTACTGAAGCTATAAGACGAGAAGAGGAGAAGACGCCTGTATTTGGACGACTGCTTTATTTAATAAGGGCACAGACTTATCAATTGGTCCGGGATCTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.45

Weight (kDa)

10.74

Isoelectric Point (pI)

37.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 144
AcyI GRCGYC 1 cut(s) 152
AfiI CCNNNNNNNGG 1 cut(s) 161
AluBI AGCT 1 cut(s) 128
AluI AGCT 1 cut(s) 128
Alw26I GTCTC 1 cut(s) 98
AspS9I GGNCC 1 cut(s) 205
AsuC2I CCSGG 1 cut(s) 209
AvaII GGWCC 1 cut(s) 205
BaeGI GKGCMC 1 cut(s) 190
BbsI GAAGAC 1 cut(s) 155
BcnI CCSGG 1 cut(s) 209
BcoDI GTCTC 1 cut(s) 98
Bme1390I CCNGG 1 cut(s) 209
Bme18I GGWCC 1 cut(s) 205
BmgT120I GGNCC 1 cut(s) 205
BmrFI CCNGG 1 cut(s) 209
BpiI GAAGAC 1 cut(s) 155
BpuMI CCSGG 1 cut(s) 209
BsaHI GRCGYC 1 cut(s) 152
BsaI GGTCTC 1 cut(s) 98
Bsc4I CCNNNNNNNGG 1 cut(s) 161
BseLI CCNNNNNNNGG 1 cut(s) 161
BseRI GAGGAG 1 cut(s) 158
BseSI GKGCMC 1 cut(s) 190
Bsh1285I CGRYCG 1 cut(s) 102
BsiEI CGRYCG 1 cut(s) 102
BsiSI CCGG 1 cut(s) 208
BslI CCNNNNNNNGG 1 cut(s) 161
BsmAI GTCTC 1 cut(s) 98
Bso31I GGTCTC 1 cut(s) 98
Bsp1286I GDGCHC 1 cut(s) 190
Bsp143I GATC 2 cut(s) 99, 211
BspTNI GGTCTC 1 cut(s) 98
BssMI GATC 2 cut(s) 99, 211
BssNI GRCGYC 1 cut(s) 152
Bst6I CTCTTC 1 cut(s) 135
BstACI GRCGYC 1 cut(s) 152
BstKTI GATC 2 cut(s) 102, 214
BstMAI GTCTC 1 cut(s) 98
BstMBI GATC 2 cut(s) 99, 211
BstMCI CGRYCG 1 cut(s) 102
BstSCI CCNGG 1 cut(s) 207
BstSLI GKGCMC 1 cut(s) 190
BstV2I GAAGAC 1 cut(s) 155
BstX2I RGATCY 1 cut(s) 211
BstYI RGATCY 1 cut(s) 211
Cfr13I GGNCC 1 cut(s) 205
CseI GACGC 1 cut(s) 160
CviJI RGCY 2 cut(s) 105, 128
CviKI_1 RGCY 2 cut(s) 105, 128
DpnI GATC 2 cut(s) 101, 213
DpnII GATC 2 cut(s) 99, 211
Eam1104I CTCTTC 1 cut(s) 135
EarI CTCTTC 1 cut(s) 135
Eco31I GGTCTC 1 cut(s) 98
Eco47I GGWCC 1 cut(s) 205
Eco57I CTGAAG 1 cut(s) 144
FaiI YATR 2 cut(s) 131, 217
HapII CCGG 1 cut(s) 208
HgaI GACGC 1 cut(s) 160
Hin1I GRCGYC 1 cut(s) 152
HpaII CCGG 1 cut(s) 208
Hpy166II GTNNAC 1 cut(s) 120
Hpy188III TCNNGA 1 cut(s) 97
Hpy8I GTNNAC 1 cut(s) 120
Hsp92I GRCGYC 1 cut(s) 152
Kzo9I GATC 2 cut(s) 99, 211
LpnPI CCDG 1 cut(s) 168
MalI GATC 2 cut(s) 101, 213
MboI GATC 2 cut(s) 99, 211
MboII GAAGA 3 cut(s) 52, 152, 160
MfeI CAATTG 1 cut(s) 200
MflI RGATCY 1 cut(s) 211
MhlI GDGCHC 1 cut(s) 190
MluCI AATT 3 cut(s) 29, 60, 200
MnlI CCTC 4 cut(s) 59, 74, 83, 136
MseI TTAA 2 cut(s) 32, 179
MspI CCGG 1 cut(s) 208
MspR9I CCNGG 1 cut(s) 209
MunI CAATTG 1 cut(s) 200
NciI CCSGG 1 cut(s) 209
NdeII GATC 2 cut(s) 99, 211
PfoI TCCNGGA 1 cut(s) 207
Ple19I CGATCG 1 cut(s) 102
PspPI GGNCC 1 cut(s) 205
PsuI RGATCY 1 cut(s) 211
PvuI CGATCG 1 cut(s) 102
SaqAI TTAA 2 cut(s) 32, 179
Sau3AI GATC 2 cut(s) 99, 211
Sau96I GGNCC 1 cut(s) 205
ScrFI CCNGG 1 cut(s) 209
SduI GDGCHC 1 cut(s) 190
SetI ASST 3 cut(s) 85, 94, 130
SgeI CNNG 5 cut(s) 21, 101, 109, 149, 167
SinI GGWCC 1 cut(s) 205
Sse9I AATT 3 cut(s) 29, 60, 200
StyD4I CCNGG 1 cut(s) 207
TaqI TCGA 2 cut(s) 88, 98
TasI AATT 3 cut(s) 29, 60, 200
Tru1I TTAA 2 cut(s) 32, 179
Tru9I TTAA 2 cut(s) 32, 179
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 41
VpaK11BI GGWCC 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.