Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr5B

Orthogroup ID

OG0002039

Physical Location & Seq

Genomic Coordinates Forward (+)

2890273 .. 2890593

Gene Structure 321 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh5BG039900.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 321 bp

ATGCAGGGAGAATGTTATCGAATTCAGATTCAGAAGCTAATAGAAGATGTTAAGGATTTGTTTGGTGAATGTAAGGAATTGGGTTTACTAGCTAAGTTGGAGCTGATTGACAGCATCCAAAAACTAGGCCTGAACAACTACTTTGAGAAGGAAATCAAGGAAACCCTAGACACCATAGCATCTGTCGAACTGAAAGACAACAACAATCCCTTCATTAGTTCAGAGGGTGATCTCTACGCTACAACACTACTCTTTAAGATTCTGAGGCAGCATGGTAATAAAGTTTCACAAGGTATAGACGCAGATGTACTAATTAGTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0006629 GO:0006720 GO:0008150 GO:0008152 GO:0008299 GO:0008610 GO:0009058 GO:0009987 GO:0010333 GO:0010334 GO:0016829 GO:0016835 GO:0016838 GO:0042214 GO:0044237 GO:0044238 GO:0044249 GO:0044255 GO:0046246 GO:0051761 GO:0051762 GO:0071704 GO:1901576

KEGG Pathways

Metabolic & Signaling

ko00909 ko01110 map00909 map01110

Pfam Domains

Protein Families

Terpene_synth Terpene_synth_C

Protein Analysis

106

Amino Acids

11.99

Weight (kDa)

4.71

Isoelectric Point (pI)

28.88

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Terpene_synth	PF01397	4 - 97	3.6e-20	Terpene synthase, N-terminal domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002039)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g03000
malus_domestica	MD10G1311000.v1.1
prunus_persica	Prupe.4G029900_v2.0.a1 Prupe.4G125200_v2.0.a1 Prupe.4G125300_v2.0.a1 Prupe.4G125300_v2.0.a1 Prupe.4G125500_v2.0.a1 Prupe.4G126400_v2.0.a1 Prupe.4G126600_v2.0.a1 Prupe.4G126600_v2.0.a1
pyrus_communis	pycom10g26190
rosa_chinensis	RchiOBHm_Chr1g0331201 RchiOBHm_Chr1g0331211 RchiOBHm_Chr5g0004591 RchiOBHm_Chr5g0004631 RchiOBHm_Chr5g0029171 RchiOBHm_Chr5g0029181 RchiOBHm_Chr5g0029221 RchiOBHm_Chr5g0029231
rosa_laevigata	RLG00000031243 RLG00000031247 RLG00000031248
rosa_multiflora	Rmu_sc0003758.1_g000015 Rmu_sc0005711.1_g000009 Rmu_sc0012347.1_g000002
rosa_roxburghii	Rroxscaffold_1G00070900 Rroxscaffold_1G00070960
rosa_rugosa	Rorug04G0412300 Rorug04G0412700 Rorug04G0412800 Rorug04G0412900 Rorug04G0413000
rosa_samantha	Rh1AG116200 Rh1DG120600 Rh5AG040400 Rh5BG039900 Rh5CG043700 Rh5CG044200 Rh5CG224800 Rh5DG039500 Rh5DG039600 Rh5DG040200
rosa_wichuraiana	Rw1G009340 Rw5G003880 Rw5G003920

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	21
AfaI	GTAC	1 cut(s)	309
AluBI	AGCT	3 cut(s)	37, 92, 103
AluI	AGCT	3 cut(s)	37, 92, 103
AoxI	GGCC	1 cut(s)	127
ApeKI	GCWGC	1 cut(s)	268
ApoI	RAATTY	1 cut(s)	21
AsuHPI	GGTGA	2 cut(s)	77, 239
BbvI	GCAGC	1 cut(s)	280
BfaI	CTAG	3 cut(s)	89, 125, 167
BisI	GCNGC	1 cut(s)	269
BlsI	GCNGC	1 cut(s)	270
BmsI	GCATC	2 cut(s)	123, 188
BseGI	GGATG	1 cut(s)	114
BseMII	CTCAG	1 cut(s)	254
BseXI	GCAGC	1 cut(s)	280
BshFI	GGCC	1 cut(s)	129
BsnI	GGCC	1 cut(s)	129
Bsp143I	GATC	1 cut(s)	229
BspANI	GGCC	1 cut(s)	129
BspCNI	CTCAG	1 cut(s)	255
BssMI	GATC	1 cut(s)	229
BstDEI	CTNAG	2 cut(s)	93, 263
BstF5I	GGATG	1 cut(s)	114
BstKTI	GATC	1 cut(s)	232
BstMBI	GATC	1 cut(s)	229
BstV1I	GCAGC	1 cut(s)	280
BsuRI	GGCC	1 cut(s)	129
BtsCI	GGATG	1 cut(s)	114
CseI	GACGC	1 cut(s)	308
Csp6I	GTAC	1 cut(s)	308
CviAII	CATG	1 cut(s)	272
CviJI	RGCY	4 cut(s)	37, 92, 103, 129
CviKI_1	RGCY	4 cut(s)	37, 92, 103, 129
CviQI	GTAC	1 cut(s)	308
DdeI	CTNAG	2 cut(s)	93, 263
DpnI	GATC	1 cut(s)	231
DpnII	GATC	1 cut(s)	229
Eco147I	AGGCCT	1 cut(s)	129
EcoRI	GAATTC	1 cut(s)	21
FaeI	CATG	1 cut(s)	275
FaiI	YATR	3 cut(s)	176, 273, 296
FatI	CATG	1 cut(s)	271
Fnu4HI	GCNGC	1 cut(s)	269
FokI	GGATG	1 cut(s)	101
Fsp4HI	GCNGC	1 cut(s)	269
FspBI	CTAG	3 cut(s)	89, 125, 167
GluI	GCNGC	1 cut(s)	269
HaeIII	GGCC	1 cut(s)	129
HgaI	GACGC	1 cut(s)	308
Hin1II	CATG	1 cut(s)	275
HinfI	GANTC	2 cut(s)	28, 259
HphI	GGTGA	2 cut(s)	77, 239
Hpy166II	GTNNAC	1 cut(s)	86
Hpy188I	TCNGA	4 cut(s)	27, 33, 223, 264
Hpy8I	GTNNAC	1 cut(s)	86
HpyAV	CCTTC	2 cut(s)	142, 220
HpyCH4V	TGCA	1 cut(s)	4
HpyF3I	CTNAG	2 cut(s)	93, 263
Hsp92II	CATG	1 cut(s)	275
Kzo9I	GATC	1 cut(s)	229
LmnI	GCTCC	1 cut(s)	100
LpnPI	CCDG	1 cut(s)	143
Lsp1109I	GCAGC	1 cut(s)	280
LweI	GCATC	2 cut(s)	123, 188
MaeI	CTAG	3 cut(s)	89, 125, 167
MalI	GATC	1 cut(s)	231
MboI	GATC	1 cut(s)	229
MboII	GAAGA	1 cut(s)	56
MluCI	AATT	3 cut(s)	21, 77, 312
MmeI	TCCRAC	1 cut(s)	78
MnlI	CCTC	2 cut(s)	217, 258
MseI	TTAA	2 cut(s)	51, 255
NdeII	GATC	1 cut(s)	229
NlaIII	CATG	1 cut(s)	275
PceI	AGGCCT	1 cut(s)	129
PfeI	GAWTC	2 cut(s)	28, 259
PkrI	GCNGC	1 cut(s)	270
RsaI	GTAC	1 cut(s)	309
RsaNI	GTAC	1 cut(s)	308
SaqAI	TTAA	2 cut(s)	51, 255
SatI	GCNGC	1 cut(s)	269
Sau3AI	GATC	1 cut(s)	229
SetI	ASST	4 cut(s)	39, 94, 105, 295
SfaNI	GCATC	2 cut(s)	123, 188
SgeI	CNNG	8 cut(s)	17, 101, 137, 142, 169, 179, 284, 302
Sse9I	AATT	3 cut(s)	21, 77, 312
SseBI	AGGCCT	1 cut(s)	129
SspMI	CTAG	3 cut(s)	89, 125, 167
StuI	AGGCCT	1 cut(s)	129
TaqI	TCGA	2 cut(s)	19, 186
TasI	AATT	3 cut(s)	21, 77, 312
TatI	WGTACW	1 cut(s)	307
TfiI	GAWTC	2 cut(s)	28, 259
Tru1I	TTAA	2 cut(s)	51, 255
Tru9I	TTAA	2 cut(s)	51, 255
TseI	GCWGC	1 cut(s)	268
TspDTI	ATGAA	1 cut(s)	202
XapI	RAATTY	1 cut(s)	21
XspI	CTAG	3 cut(s)	89, 125, 167

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.