Rh5DG039500

(E,E)-alpha-farnesene

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
2886124 .. 2886444
321 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG039500.1

Sequence Viewer

Length: 321 bp
ATGCAGGCAGAATGTTATCGAATTCAGATTCAGAAGCTAATAAAAGATGTTAAGGATTTGTTTGGTGAATCTAAGGAATTAGGTTTACTAGATAAGTTGGAGCTGATTGACAGCATCCAAAAACTAGTCTTGAACAGCTACTTTGAGAAGGAAATCAAGGAAACCCTAGACACCATAGCATCTGTCGAACTGAAAAACAATAGCAATCCCTTCATTAGTTCAGAGGGTGATCTCTATGCTACAGCACTACTCTTTAAGATTCTGAGGCAGTATGGTTATAAAGTTTCACAAGGTATAGACGCAGATGTACTAATTAGTTGA

Protein Analysis

106

Amino Acids

12.06

Weight (kDa)

4.8

Isoelectric Point (pI)

16.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Terpene_synth PF01397 3 - 97 9.4e-21 Terpene synthase, N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 279
AcsI RAATTY 1 cut(s) 21
AfaI GTAC 1 cut(s) 309
AgsI TTSAA 1 cut(s) 133
AhlI ACTAGT 1 cut(s) 124
AluBI AGCT 3 cut(s) 37, 103, 138
AluI AGCT 3 cut(s) 37, 103, 138
ApoI RAATTY 1 cut(s) 21
AsuHPI GGTGA 2 cut(s) 77, 239
BcuI ACTAGT 1 cut(s) 124
BfaI CTAG 3 cut(s) 89, 125, 167
BfmI CTRYAG 1 cut(s) 240
BmsI GCATC 2 cut(s) 123, 188
BseGI GGATG 1 cut(s) 114
BseMII CTCAG 1 cut(s) 254
Bsp143I GATC 1 cut(s) 229
BspCNI CTCAG 1 cut(s) 255
BssMI GATC 1 cut(s) 229
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 2 cut(s) 72, 263
BstF5I GGATG 1 cut(s) 114
BstKTI GATC 1 cut(s) 232
BstMBI GATC 1 cut(s) 229
BstSFI CTRYAG 1 cut(s) 240
BtsCI GGATG 1 cut(s) 114
Cac8I GCNNGC 1 cut(s) 6
CseI GACGC 1 cut(s) 308
Csp6I GTAC 1 cut(s) 308
CviJI RGCY 3 cut(s) 37, 103, 138
CviKI_1 RGCY 3 cut(s) 37, 103, 138
CviQI GTAC 1 cut(s) 308
DdeI CTNAG 2 cut(s) 72, 263
DpnI GATC 1 cut(s) 231
DpnII GATC 1 cut(s) 229
EcoRI GAATTC 1 cut(s) 21
FaiI YATR 5 cut(s) 176, 237, 273, 279, 296
FokI GGATG 1 cut(s) 101
FspBI CTAG 3 cut(s) 89, 125, 167
HgaI GACGC 1 cut(s) 308
HinfI GANTC 3 cut(s) 28, 68, 259
HphI GGTGA 2 cut(s) 77, 239
Hpy166II GTNNAC 1 cut(s) 86
Hpy188I TCNGA 4 cut(s) 27, 33, 223, 264
Hpy188III TCNNGA 1 cut(s) 130
Hpy8I GTNNAC 1 cut(s) 86
HpyAV CCTTC 2 cut(s) 142, 220
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 2 cut(s) 72, 263
Kzo9I GATC 1 cut(s) 229
LmnI GCTCC 1 cut(s) 100
LweI GCATC 2 cut(s) 123, 188
MaeI CTAG 3 cut(s) 89, 125, 167
MalI GATC 1 cut(s) 231
MboI GATC 1 cut(s) 229
MluCI AATT 3 cut(s) 21, 77, 312
MmeI TCCRAC 1 cut(s) 78
MnlI CCTC 2 cut(s) 217, 258
MseI TTAA 2 cut(s) 51, 255
NdeII GATC 1 cut(s) 229
PfeI GAWTC 3 cut(s) 28, 68, 259
PsiI TTATAA 1 cut(s) 279
RsaI GTAC 1 cut(s) 309
RsaNI GTAC 1 cut(s) 308
SaqAI TTAA 2 cut(s) 51, 255
Sau3AI GATC 1 cut(s) 229
SetI ASST 5 cut(s) 39, 85, 105, 140, 295
SfaNI GCATC 2 cut(s) 123, 188
SfcI CTRYAG 1 cut(s) 240
SgeI CNNG 7 cut(s) 17, 101, 137, 142, 169, 179, 302
SpeI ACTAGT 1 cut(s) 124
Sse9I AATT 3 cut(s) 21, 77, 312
SspMI CTAG 3 cut(s) 89, 125, 167
TaqI TCGA 2 cut(s) 19, 186
TasI AATT 3 cut(s) 21, 77, 312
TatI WGTACW 1 cut(s) 307
TfiI GAWTC 3 cut(s) 28, 68, 259
Tru1I TTAA 2 cut(s) 51, 255
Tru9I TTAA 2 cut(s) 51, 255
TspDTI ATGAA 1 cut(s) 202
XapI RAATTY 1 cut(s) 21
XspI CTAG 3 cut(s) 89, 125, 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.