AT5G36360

Prolamin-like

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Reverse (-)
14335668 .. 14336024
357 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G36360.1

Sequence Viewer

Length: 357 bp
ATGTCTATCAAAAATGTGTTTTTACTTCTAGCGGTTCTATGTATCATAGTTTCTGTAAATGCTCAATTGCCTCAGTTTCCGGCTCAACTTCCTTTTCTGTTTCCGTTCCAACTTATTCCTGGATTACCTGATATAACAAAATGTTTCTCATCCGTGATGGATATTCCTGGATGCATTGCAGAGATTTCTCAATCCATTTTCACTGGAAAGTTCGGTAATTTAGGTCCGGCTTGTTGCAAAGCATTTTTGGACGCCGATAATTGCATACCGAAAATTCCATTCATTCCATTTTTTCCTCCGATGCTAAAGGAACAATGTTCAAGAGTTGCCGGTGCAACTCCTCCCATACCAAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

118

Amino Acids

12.77

Weight (kDa)

8.2

Isoelectric Point (pI)

42.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Prolamin_like PF05617 47 - 107 3.8e-09 Prolamin-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 32
AcsI RAATTY 1 cut(s) 273
AcyI GRCGYC 1 cut(s) 252
AgsI TTSAA 1 cut(s) 321
AjnI CCWGG 2 cut(s) 118, 166
ApoI RAATTY 1 cut(s) 273
AspS9I GGNCC 1 cut(s) 224
AvaII GGWCC 1 cut(s) 224
BccI CCATC 1 cut(s) 151
BciT130I CCWGG 2 cut(s) 120, 168
BfaI CTAG 1 cut(s) 29
Bme1390I CCNGG 2 cut(s) 120, 168
Bme18I GGWCC 1 cut(s) 224
BmgT120I GGNCC 1 cut(s) 224
BmrFI CCNGG 2 cut(s) 120, 168
BmsI GCATC 2 cut(s) 161, 291
BsaHI GRCGYC 1 cut(s) 252
Bse118I RCCGGY 1 cut(s) 329
Bse1I ACTGG 1 cut(s) 208
Bse3DI GCAATG 1 cut(s) 174
BseBI CCWGG 2 cut(s) 120, 168
BseGI GGATG 2 cut(s) 149, 176
BseMI GCAATG 1 cut(s) 174
BseMII CTCAG 1 cut(s) 86
BseNI ACTGG 1 cut(s) 208
BseRI GAGGAG 1 cut(s) 330
BsiSI CCGG 3 cut(s) 80, 227, 330
BspACI CCGC 1 cut(s) 32
BspCNI CTCAG 1 cut(s) 85
BsrDI GCAATG 1 cut(s) 174
BsrFI RCCGGY 1 cut(s) 329
BsrI ACTGG 1 cut(s) 208
BssAI RCCGGY 1 cut(s) 329
BssNI GRCGYC 1 cut(s) 252
Bst2UI CCWGG 2 cut(s) 120, 168
BstACI GRCGYC 1 cut(s) 252
BstDEI CTNAG 1 cut(s) 72
BstF5I GGATG 2 cut(s) 149, 176
BstNI CCWGG 2 cut(s) 120, 168
BstSCI CCNGG 2 cut(s) 118, 166
BtsCI GGATG 2 cut(s) 149, 176
BtsIMutI CAGTG 1 cut(s) 201
Cfr10I RCCGGY 1 cut(s) 329
Cfr13I GGNCC 1 cut(s) 224
CseI GACGC 1 cut(s) 260
CviJI RGCY 2 cut(s) 83, 230
CviKI_1 RGCY 2 cut(s) 83, 230
DdeI CTNAG 1 cut(s) 72
Eco47I GGWCC 1 cut(s) 224
EcoRII CCWGG 2 cut(s) 118, 166
EcoT22I ATGCAT 1 cut(s) 176
FaiI YATR 5 cut(s) 40, 47, 134, 266, 347
FokI GGATG 2 cut(s) 136, 183
FspBI CTAG 1 cut(s) 29
HapII CCGG 3 cut(s) 80, 227, 330
HgaI GACGC 1 cut(s) 260
Hin1I GRCGYC 1 cut(s) 252
HpaII CCGG 3 cut(s) 80, 227, 330
Hpy188I TCNGA 1 cut(s) 300
Hpy188III TCNNGA 1 cut(s) 321
HpyCH4V TGCA 5 cut(s) 174, 179, 237, 264, 335
HpyF3I CTNAG 1 cut(s) 72
Hsp92I GRCGYC 1 cut(s) 252
LpnPI CCDG 9 cut(s) 93, 105, 132, 141, 153, 180, 189, 240, 343
LweI GCATC 2 cut(s) 161, 291
MaeI CTAG 1 cut(s) 29
MfeI CAATTG 1 cut(s) 65
MluCI AATT 4 cut(s) 65, 217, 259, 273
MmeI TCCRAC 1 cut(s) 133
MnlI CCTC 3 cut(s) 81, 306, 351
Mph1103I ATGCAT 1 cut(s) 176
MspI CCGG 3 cut(s) 80, 227, 330
MspR9I CCNGG 2 cut(s) 120, 168
MunI CAATTG 1 cut(s) 65
MvaI CCWGG 2 cut(s) 120, 168
NsiI ATGCAT 1 cut(s) 176
PfoI TCCNGGA 2 cut(s) 118, 166
Psp6I CCWGG 2 cut(s) 118, 166
PspGI CCWGG 2 cut(s) 118, 166
PspPI GGNCC 1 cut(s) 224
Sau96I GGNCC 1 cut(s) 224
ScrFI CCNGG 2 cut(s) 120, 168
SetI ASST 2 cut(s) 130, 226
SfaNI GCATC 2 cut(s) 161, 291
SinI GGWCC 1 cut(s) 224
Sse9I AATT 4 cut(s) 65, 217, 259, 273
SsiI CCGC 1 cut(s) 32
SspMI CTAG 1 cut(s) 29
StyD4I CCNGG 2 cut(s) 118, 166
TasI AATT 4 cut(s) 65, 217, 259, 273
TscAI CASTG 1 cut(s) 208
TspDTI ATGAA 1 cut(s) 271
TspGWI ACGGA 2 cut(s) 93, 142
TspRI CASTG 1 cut(s) 208
VpaK11BI GGWCC 1 cut(s) 224
XapI RAATTY 1 cut(s) 273
XcmI CCANNNNNNNNNTGG 1 cut(s) 116
XspI CTAG 1 cut(s) 29
Zsp2I ATGCAT 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.