AT5G60945

Prolamin-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0000547
Physical Location & Seq
Forward (+)
24526245 .. 24526636
392 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G60945.1

Sequence Viewer

Length: 339 bp
ATGTCTACTAAAAATGTGATTTCATTTTTAATGGTCATATGCATCATAGTCTCCGTAAATGCAAGACCACTTTTTTCGTCTATTTTTACTGATCCATATCCGTACCTTAATAGTTTACCAGGATTTTTTCATGTATTCAGATGTTATTCATCTGTGATGAAATTTCCAATATGCGTTATACAAACTACTGAATCCGTACGTAATAAGCGATGGGAAATCAGTCCTTATTGTTGCAAGGCATATTTACATACCAAAGATTACTGCTTGCCAAAAATTCCCTACATGCCAAAATTTCCTTCTTTCATAAGAAATCATTGTAAAAAAGTTGTTCGCAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Prolamin_like

Protein Analysis

112

Amino Acids

13.17

Weight (kDa)

9.65

Isoelectric Point (pI)

55.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Prolamin_like PF05617 48 - 106 8.9e-06 Prolamin-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 5
AclWI GGATC 1 cut(s) 86
AcsI RAATTY 3 cut(s) 161, 273, 290
AfaI GTAC 2 cut(s) 104, 198
AjnI CCWGG 1 cut(s) 118
AjuI GAANNNNNNNTTGG 2 cut(s) 280, 312
Alw26I GTCTC 1 cut(s) 55
AlwI GGATC 1 cut(s) 86
ApoI RAATTY 3 cut(s) 161, 273, 290
BccI CCATC 1 cut(s) 204
BciT130I CCWGG 1 cut(s) 120
BcoDI GTCTC 1 cut(s) 55
Bme1390I CCNGG 1 cut(s) 120
BmrFI CCNGG 1 cut(s) 120
BmsI GCATC 1 cut(s) 51
BsaAI YACGTR 1 cut(s) 200
BsaBI GATNNNNATC 1 cut(s) 96
Bse8I GATNNNNATC 1 cut(s) 96
BseBI CCWGG 1 cut(s) 120
BseJI GATNNNNATC 1 cut(s) 96
BsiWI CGTACG 1 cut(s) 196
BsmAI GTCTC 1 cut(s) 55
Bsp143I GATC 1 cut(s) 91
BspPI GGATC 1 cut(s) 86
BssMI GATC 1 cut(s) 91
Bst2UI CCWGG 1 cut(s) 120
BstBAI YACGTR 1 cut(s) 200
BstC8I GCNNGC 1 cut(s) 266
BstKTI GATC 1 cut(s) 94
BstMAI GTCTC 1 cut(s) 55
BstMBI GATC 1 cut(s) 91
BstNI CCWGG 1 cut(s) 120
BstNSI RCATGY 1 cut(s) 286
BstSCI CCNGG 1 cut(s) 118
BstSNI TACGTA 1 cut(s) 200
BtgZI GCGATG 1 cut(s) 223
Cac8I GCNNGC 1 cut(s) 266
Csp6I GTAC 2 cut(s) 103, 197
CviAII CATG 2 cut(s) 131, 283
CviQI GTAC 2 cut(s) 103, 197
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
Eco105I TACGTA 1 cut(s) 200
EcoRII CCWGG 1 cut(s) 118
EcoT22I ATGCAT 1 cut(s) 44
FaeI CATG 2 cut(s) 134, 286
FatI CATG 2 cut(s) 130, 282
FauNDI CATATG 1 cut(s) 38
FblI GTMKAC 1 cut(s) 5
Hin1II CATG 2 cut(s) 134, 286
HinfI GANTC 1 cut(s) 191
Hpy166II GTNNAC 2 cut(s) 6, 116
Hpy188I TCNGA 1 cut(s) 140
Hpy8I GTNNAC 2 cut(s) 6, 116
HpyAV CCTTC 1 cut(s) 306
HpyCH4IV ACGT 1 cut(s) 199
HpyCH4V TGCA 3 cut(s) 42, 62, 234
HpySE526I ACGT 1 cut(s) 199
Hsp92II CATG 2 cut(s) 134, 286
Kzo9I GATC 1 cut(s) 91
LpnPI CCDG 2 cut(s) 105, 132
LweI GCATC 1 cut(s) 51
MaeII ACGT 1 cut(s) 199
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MluCI AATT 3 cut(s) 161, 273, 290
Mph1103I ATGCAT 1 cut(s) 44
MseI TTAA 2 cut(s) 29, 108
MspR9I CCNGG 1 cut(s) 120
MvaI CCWGG 1 cut(s) 120
NdeI CATATG 1 cut(s) 38
NdeII GATC 1 cut(s) 91
NlaIII CATG 2 cut(s) 134, 286
NsiI ATGCAT 1 cut(s) 44
NspI RCATGY 1 cut(s) 286
PcsI WCGNNNNNNNCGW 1 cut(s) 205
PfeI GAWTC 1 cut(s) 191
Pfl23II CGTACG 1 cut(s) 196
Ppu21I YACGTR 1 cut(s) 200
Psp6I CCWGG 1 cut(s) 118
PspGI CCWGG 1 cut(s) 118
PspLI CGTACG 1 cut(s) 196
RsaI GTAC 2 cut(s) 104, 198
RsaNI GTAC 2 cut(s) 103, 197
SaqAI TTAA 2 cut(s) 29, 108
Sau3AI GATC 1 cut(s) 91
ScrFI CCNGG 1 cut(s) 120
SetI ASST 2 cut(s) 108, 202
SfaNI GCATC 1 cut(s) 51
SgeI CNNG 7 cut(s) 75, 131, 132, 143, 247, 277, 295
SnaBI TACGTA 1 cut(s) 200
Sse9I AATT 3 cut(s) 161, 273, 290
StyD4I CCNGG 1 cut(s) 118
TaiI ACGT 1 cut(s) 202
TasI AATT 3 cut(s) 161, 273, 290
TfiI GAWTC 1 cut(s) 191
Tru1I TTAA 2 cut(s) 29, 108
Tru9I TTAA 2 cut(s) 29, 108
TspDTI ATGAA 5 cut(s) 12, 119, 138, 173, 292
TspGWI ACGGA 3 cut(s) 43, 90, 184
XapI RAATTY 3 cut(s) 161, 273, 290
XceI RCATGY 1 cut(s) 286
XmiI GTMKAC 1 cut(s) 5
Zsp2I ATGCAT 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.