AT5G60964

Prolamin-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0000547
Physical Location & Seq
Forward (+)
24530572 .. 24530924
353 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G60964.1

Sequence Viewer

Length: 339 bp
ATGTCTATTAAAAATGTGATTTCACTTTTAATGGTCATATGCATTATAGTCTCCGTAAATGCAAGGCCACCATTTTCGTCTATTTTTACTGATCCATATCCGTTACTTAATAGTTTTCCAGTATTTTCTCGTATATTCAAATGTTATTCATCTGTGATGAAATTTCCAATATGCGTTATAGAAACTACTCAATCCGTATCTAATAGGCGATGGGTGATTAGTCCTTATTGTTGCAAGGCATATTTACATACCAGAGATTACTGCTTGCCAAAAATTCCATACATGCCACATTTTCCTTCTTTCATAAGAAATCATTGTTTAAAAGTTGTTAGAAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

13.05

Weight (kDa)

9.68

Isoelectric Point (pI)

60.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Prolamin_like PF05617 47 - 106 7.6e-06 Prolamin-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 86
AcsI RAATTY 2 cut(s) 161, 273
AgsI TTSAA 1 cut(s) 139
Alw26I GTCTC 1 cut(s) 55
AlwI GGATC 1 cut(s) 86
AoxI GGCC 1 cut(s) 65
ApoI RAATTY 2 cut(s) 161, 273
AsuHPI GGTGA 1 cut(s) 226
BccI CCATC 1 cut(s) 204
BcoDI GTCTC 1 cut(s) 55
BsaBI GATNNNNATC 1 cut(s) 96
Bse1I ACTGG 1 cut(s) 119
Bse8I GATNNNNATC 1 cut(s) 96
BseJI GATNNNNATC 1 cut(s) 96
BseNI ACTGG 1 cut(s) 119
BshFI GGCC 1 cut(s) 67
BsmAI GTCTC 1 cut(s) 55
BsnI GGCC 1 cut(s) 67
Bsp143I GATC 1 cut(s) 91
BspANI GGCC 1 cut(s) 67
BspPI GGATC 1 cut(s) 86
BsrI ACTGG 1 cut(s) 119
BssMI GATC 1 cut(s) 91
BstC8I GCNNGC 1 cut(s) 266
BstKTI GATC 1 cut(s) 94
BstMAI GTCTC 1 cut(s) 55
BstMBI GATC 1 cut(s) 91
BstNSI RCATGY 1 cut(s) 286
BsuRI GGCC 1 cut(s) 67
BtgZI GCGATG 1 cut(s) 223
Cac8I GCNNGC 1 cut(s) 266
CviAII CATG 1 cut(s) 283
CviJI RGCY 1 cut(s) 67
CviKI_1 RGCY 1 cut(s) 67
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
DraI TTTAAA 1 cut(s) 321
EcoT22I ATGCAT 1 cut(s) 44
FaeI CATG 1 cut(s) 286
FatI CATG 1 cut(s) 282
FauNDI CATATG 1 cut(s) 38
HaeIII GGCC 1 cut(s) 67
Hin1II CATG 1 cut(s) 286
HphI GGTGA 1 cut(s) 226
HpyAV CCTTC 1 cut(s) 306
HpyCH4V TGCA 3 cut(s) 42, 62, 234
Hsp92II CATG 1 cut(s) 286
Kzo9I GATC 1 cut(s) 91
LpnPI CCDG 2 cut(s) 132, 265
MaeIII GTNAC 1 cut(s) 102
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MluCI AATT 2 cut(s) 161, 273
Mph1103I ATGCAT 1 cut(s) 44
MseI TTAA 4 cut(s) 9, 29, 108, 320
NdeI CATATG 1 cut(s) 38
NdeII GATC 1 cut(s) 91
NlaIII CATG 1 cut(s) 286
NsiI ATGCAT 1 cut(s) 44
NspI RCATGY 1 cut(s) 286
SaqAI TTAA 4 cut(s) 9, 29, 108, 320
Sau3AI GATC 1 cut(s) 91
SgeI CNNG 7 cut(s) 75, 131, 141, 247, 264, 277, 295
Sse9I AATT 2 cut(s) 161, 273
TasI AATT 2 cut(s) 161, 273
Tru1I TTAA 4 cut(s) 9, 29, 108, 320
Tru9I TTAA 4 cut(s) 9, 29, 108, 320
TspDTI ATGAA 3 cut(s) 138, 173, 292
TspGWI ACGGA 3 cut(s) 43, 90, 184
XapI RAATTY 2 cut(s) 161, 273
XceI RCATGY 1 cut(s) 286
Zsp2I ATGCAT 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.