MD04G1097100.v1.1

Belongs to the universal ribosomal protein uS13 family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
Physical Location & Seq
Reverse (-)
17978247 .. 17978420
174 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1097100.v1.1.491

Sequence Viewer

Length: 174 bp
ATGGAAAGAAGAAGATCATGTTTCGCCATTACCTTCATCAAGGGTATCGGTAGACGTTTCGCCGACATCGTCTATAAGAAGGCTGATGTCGACATGAACAAAAGGGCTAGTGAGCTATCTGCTACCGAGCTCGACAATCTATTGACTATTGTGGCAACCCCCTCCCTCAGTTGA

Protein Analysis

58

Amino Acids

6.42

Weight (kDa)

9.51

Isoelectric Point (pI)

61.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S13 PF00416 4 - 53 1.4e-11 Ribosomal protein S13/S18
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 52, 90
AluBI AGCT 2 cut(s) 115, 130
AluI AGCT 2 cut(s) 115, 130
Alw21I GWGCWC 1 cut(s) 132
BanII GRGCYC 1 cut(s) 132
Bbv12I GWGCWC 1 cut(s) 132
BfaI CTAG 1 cut(s) 108
BsiHKAI GWGCWC 1 cut(s) 132
Bsp1286I GDGCHC 1 cut(s) 132
Bsp143I GATC 1 cut(s) 14
BssMI GATC 1 cut(s) 14
BstDEI CTNAG 1 cut(s) 167
BstKTI GATC 1 cut(s) 17
BstMBI GATC 1 cut(s) 14
CviAII CATG 2 cut(s) 18, 94
CviJI RGCY 4 cut(s) 83, 107, 115, 130
CviKI_1 RGCY 4 cut(s) 83, 107, 115, 130
DdeI CTNAG 1 cut(s) 167
DpnI GATC 1 cut(s) 16
DpnII GATC 1 cut(s) 14
Ecl136II GAGCTC 1 cut(s) 130
Eco24I GRGCYC 1 cut(s) 132
Eco53kI GAGCTC 1 cut(s) 130
EcoICRI GAGCTC 1 cut(s) 130
EcoT38I GRGCYC 1 cut(s) 132
FaeI CATG 2 cut(s) 21, 97
FaiI YATR 3 cut(s) 19, 75, 95
FatI CATG 2 cut(s) 17, 93
FblI GTMKAC 2 cut(s) 52, 90
FriOI GRGCYC 1 cut(s) 132
FspBI CTAG 1 cut(s) 108
Hin1II CATG 2 cut(s) 21, 97
HincII GTYRAC 1 cut(s) 91
HindII GTYRAC 1 cut(s) 91
Hpy166II GTNNAC 2 cut(s) 53, 91
Hpy8I GTNNAC 2 cut(s) 53, 91
HpyAV CCTTC 2 cut(s) 43, 73
HpyCH4IV ACGT 1 cut(s) 55
HpyF3I CTNAG 1 cut(s) 167
HpySE526I ACGT 1 cut(s) 55
Hsp92II CATG 2 cut(s) 21, 97
Kzo9I GATC 1 cut(s) 14
MaeI CTAG 1 cut(s) 108
MaeII ACGT 1 cut(s) 55
MalI GATC 1 cut(s) 16
MboI GATC 1 cut(s) 14
MboII GAAGA 2 cut(s) 21, 24
MhlI GDGCHC 1 cut(s) 132
MnlI CCTC 1 cut(s) 172
NdeII GATC 1 cut(s) 14
NlaIII CATG 2 cut(s) 21, 97
PcsI WCGNNNNNNNCGW 1 cut(s) 66
PflFI GACNNNGTC 1 cut(s) 68
Psp124BI GAGCTC 1 cut(s) 132
PsyI GACNNNGTC 1 cut(s) 68
SacI GAGCTC 1 cut(s) 132
SalI GTCGAC 1 cut(s) 89
Sau3AI GATC 1 cut(s) 14
SduI GDGCHC 1 cut(s) 132
SetI ASST 4 cut(s) 35, 58, 117, 132
SgeI CNNG 6 cut(s) 30, 52, 106, 120, 139, 143
SspMI CTAG 1 cut(s) 108
SstI GAGCTC 1 cut(s) 132
TaiI ACGT 1 cut(s) 58
TaqI TCGA 2 cut(s) 90, 132
TspDTI ATGAA 2 cut(s) 25, 110
Tth111I GACNNNGTC 1 cut(s) 68
XmiI GTMKAC 2 cut(s) 52, 90
XspI CTAG 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.