MD15G1256400.v1.1

Heavy-metal-associated domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
OG0001393
Physical Location & Seq
Reverse (-)
21763972 .. 21765060
1089 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1256400.v1.1.491

Sequence Viewer

Length: 393 bp
ATGGTACAAAGGACTGTCCTCAAGGTTGATACATCATGCCTAAAATGCAAGAAGAAGCTTCTCAAGGCAGTTTCTGGCCTACAAGGTGTGGATAAAGTTGAAGTTGATGCAACCAAAGGAACTTTGACTGTAACAGGCAACTGTGATCCCTATGAAATAATTATTCGAACTAGAAAAGCTGGCAAATTTGCTGAAGTAGTGAGTATAGGGCCGCCTCCTGCTCCACCTAAACCTGCAGAAAAGAAGCCCGAAGTGAAGAAACCTGAAGAAAAAAAACCAGACCAGAAGGTCGAACACTTTCACATGCCCCATAACTGTGAAGTATGTCAAAGATTGGCCATTGTAAGGCTGGAGCCTAGTTATGATCACAACCCCTCCTGTTCTATCATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HMA

Protein Analysis

131

Amino Acids

14.43

Weight (kDa)

9.15

Isoelectric Point (pI)

28.51

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HMA PF00403 7 - 62 1.6e-10 Heavy-metal-associated domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 287
Acc36I ACCTGC 1 cut(s) 241
AciI CCGC 1 cut(s) 212
AclWI GGATC 1 cut(s) 140
AcoI YGGCCR 1 cut(s) 336
AcsI RAATTY 1 cut(s) 185
AcuI CTGAAG 2 cut(s) 213, 285
AfaI GTAC 1 cut(s) 6
AfiI CCNNNNNNNGG 1 cut(s) 345
AgsI TTSAA 1 cut(s) 101
AluBI AGCT 2 cut(s) 58, 179
AluI AGCT 2 cut(s) 58, 179
AlwI GGATC 1 cut(s) 140
AlwNI CAGNNNCTG 1 cut(s) 74
AoxI GGCC 3 cut(s) 76, 209, 336
ApoI RAATTY 1 cut(s) 185
Asp700I GAANNNNTTC 1 cut(s) 297
AspS9I GGNCC 1 cut(s) 209
AsuII TTCGAA 1 cut(s) 166
BalI TGGCCA 1 cut(s) 338
BclI TGATCA 1 cut(s) 364
BfaI CTAG 2 cut(s) 171, 357
BfmI CTRYAG 1 cut(s) 234
BfuAI ACCTGC 1 cut(s) 241
BisI GCNGC 1 cut(s) 212
BlsI GCNGC 1 cut(s) 213
BmgT120I GGNCC 1 cut(s) 209
BmiI GGNNCC 1 cut(s) 354
BmsI GCATC 1 cut(s) 97
BpmI CTGGAG 1 cut(s) 371
Bpu14I TTCGAA 1 cut(s) 166
BpuEI CTTGAG 2 cut(s) 5, 47
BsaXI ACNNNNNCTCC 2 cut(s) 359, 389
Bsc4I CCNNNNNNNGG 1 cut(s) 345
BseLI CCNNNNNNNGG 1 cut(s) 345
BshFI GGCC 3 cut(s) 78, 211, 338
BslI CCNNNNNNNGG 1 cut(s) 345
BsnI GGCC 3 cut(s) 78, 211, 338
Bsp119I TTCGAA 1 cut(s) 166
Bsp143I GATC 2 cut(s) 145, 364
BspACI CCGC 1 cut(s) 212
BspANI GGCC 3 cut(s) 78, 211, 338
BspLI GGNNCC 1 cut(s) 354
BspMAI CTGCAG 1 cut(s) 238
BspMI ACCTGC 1 cut(s) 241
BspPI GGATC 1 cut(s) 140
BspT104I TTCGAA 1 cut(s) 166
BssMI GATC 2 cut(s) 145, 364
Bst4CI ACNGT 4 cut(s) 16, 130, 143, 317
BstBI TTCGAA 1 cut(s) 166
BstC8I GCNNGC 1 cut(s) 181
BstKTI GATC 2 cut(s) 148, 367
BstMBI GATC 2 cut(s) 145, 364
BstMWI GCNNNNNNNGC 1 cut(s) 45
BstNSI RCATGY 1 cut(s) 307
BstSFI CTRYAG 1 cut(s) 234
BsuRI GGCC 3 cut(s) 78, 211, 338
BveI ACCTGC 1 cut(s) 241
Cac8I GCNNGC 1 cut(s) 181
CaiI CAGNNNCTG 1 cut(s) 74
Cfr13I GGNCC 1 cut(s) 209
Csp6I GTAC 1 cut(s) 5
CviAII CATG 3 cut(s) 36, 304, 388
CviJI RGCY 8 cut(s) 58, 78, 179, 211, 247, 338, 349, 355
CviKI_1 RGCY 8 cut(s) 58, 78, 179, 211, 247, 338, 349, 355
CviQI GTAC 1 cut(s) 5
DpnI GATC 2 cut(s) 147, 366
DpnII GATC 2 cut(s) 145, 364
DrdI GACNNNNNNGTC 1 cut(s) 287
DseDI GACNNNNNNGTC 1 cut(s) 287
EaeI YGGCCR 1 cut(s) 336
Eco57I CTGAAG 2 cut(s) 213, 285
FaeI CATG 3 cut(s) 39, 307, 391
FaiI YATR 8 cut(s) 37, 153, 206, 305, 312, 325, 363, 389
FatI CATG 3 cut(s) 35, 303, 387
FbaI TGATCA 1 cut(s) 364
Fnu4HI GCNGC 1 cut(s) 212
Fsp4HI GCNGC 1 cut(s) 212
FspBI CTAG 2 cut(s) 171, 357
GluI GCNGC 1 cut(s) 212
GsuI CTGGAG 1 cut(s) 371
HaeIII GGCC 3 cut(s) 78, 211, 338
Hin1II CATG 3 cut(s) 39, 307, 391
HindIII AAGCTT 1 cut(s) 56
HpyAV CCTTC 1 cut(s) 280
HpyCH4III ACNGT 4 cut(s) 16, 130, 143, 317
HpyCH4V TGCA 3 cut(s) 48, 110, 236
HpyF10VI GCNNNNNNNGC 1 cut(s) 45
Hsp92II CATG 3 cut(s) 39, 307, 391
Ksp22I TGATCA 1 cut(s) 364
Kzo9I GATC 2 cut(s) 145, 364
LmnI GCTCC 2 cut(s) 226, 352
LpnPI CCDG 9 cut(s) 60, 120, 165, 231, 246, 276, 291, 296, 335
LweI GCATC 1 cut(s) 97
MaeI CTAG 2 cut(s) 171, 357
MaeIII GTNAC 1 cut(s) 130
MalI GATC 2 cut(s) 147, 366
MboI GATC 2 cut(s) 145, 364
MboII GAAGA 3 cut(s) 64, 268, 278
MlsI TGGCCA 1 cut(s) 338
MluCI AATT 2 cut(s) 159, 185
MluNI TGGCCA 1 cut(s) 338
MnlI CCTC 3 cut(s) 29, 225, 385
Mox20I TGGCCA 1 cut(s) 338
MroXI GAANNNNTTC 1 cut(s) 297
MscI TGGCCA 1 cut(s) 338
MslI CAYNNNNRTG 1 cut(s) 315
Msp20I TGGCCA 1 cut(s) 338
MwoI GCNNNNNNNGC 1 cut(s) 45
NdeII GATC 2 cut(s) 145, 364
NlaIII CATG 3 cut(s) 39, 307, 391
NlaIV GGNNCC 1 cut(s) 354
NspI RCATGY 1 cut(s) 307
NspV TTCGAA 1 cut(s) 166
PdmI GAANNNNTTC 1 cut(s) 297
PkrI GCNGC 1 cut(s) 213
PspN4I GGNNCC 1 cut(s) 354
PspPI GGNCC 1 cut(s) 209
PstI CTGCAG 1 cut(s) 238
PstNI CAGNNNCTG 1 cut(s) 74
RsaI GTAC 1 cut(s) 6
RsaNI GTAC 1 cut(s) 5
RseI CAYNNNNRTG 1 cut(s) 315
SatI GCNGC 1 cut(s) 212
Sau3AI GATC 2 cut(s) 145, 364
Sau96I GGNCC 1 cut(s) 209
SetI ASST 8 cut(s) 27, 60, 88, 181, 229, 235, 265, 291
SfaNI GCATC 1 cut(s) 97
SfcI CTRYAG 1 cut(s) 234
SfuI TTCGAA 1 cut(s) 166
SmiMI CAYNNNNRTG 1 cut(s) 315
SmlI CTYRAG 2 cut(s) 20, 62
SmoI CTYRAG 2 cut(s) 20, 62
Sse9I AATT 2 cut(s) 159, 185
SsiI CCGC 1 cut(s) 212
SspMI CTAG 2 cut(s) 171, 357
TaaI ACNGT 4 cut(s) 16, 130, 143, 317
TaqI TCGA 2 cut(s) 166, 291
TasI AATT 2 cut(s) 159, 185
TauI GCSGC 1 cut(s) 214
TspDTI ATGAA 1 cut(s) 168
XapI RAATTY 1 cut(s) 185
XceI RCATGY 1 cut(s) 307
XcmI CCANNNNNNNNNTGG 1 cut(s) 346
XmnI GAANNNNTTC 1 cut(s) 297
XspI CTAG 2 cut(s) 171, 357
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.