Prupe.1G549900_v2.0.a1

Heavy-metal-associated domain

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
44950570 .. 44951887
1318 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G549900.1

Sequence Viewer

Length: 330 bp
ATGAAGTTAATAGCAACGGTAGAAGGGATAACTTCGATTGTCCTCGACCCATCAAAAAATACGGTGACAGTAACTGGGGATGCCAATCCAGTAAAGGTTATCAAGAAGGTGAGAAAATTCAGAAAATCTGCTTCAGTCATGAGTATAGGTCCTCCACCTCCCCAGAGTGAGAAGAAGGATGAGAAGAAAGACCTTGTTCCTTTTAACACCAAAGACATGTCAGAGATGAGTCAAACCATTCGGAGGTCCATTAACGATAAGGTCAACCGACCCATGAATGGCCAAGTCGGCCTACTGAATGGCCCAAAAAAGACAAATTCGACCCACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

110

Amino Acids

11.97

Weight (kDa)

10.17

Isoelectric Point (pI)

39.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 280
AcsI RAATTY 2 cut(s) 116, 316
AcuI CTGAAG 1 cut(s) 117
AfiI CCNNNNNNNGG 2 cut(s) 243, 278
AflIII ACRYGT 1 cut(s) 216
AlwNI CAGNNNCTG 1 cut(s) 74
AoxI GGCC 3 cut(s) 280, 289, 301
ApoI RAATTY 2 cut(s) 116, 316
AspS9I GGNCC 3 cut(s) 149, 246, 302
AsuHPI GGTGA 2 cut(s) 76, 121
AvaII GGWCC 2 cut(s) 149, 246
BalI TGGCCA 1 cut(s) 282
BccI CCATC 1 cut(s) 58
BglI GCCNNNNNGGC 1 cut(s) 288
Bme18I GGWCC 2 cut(s) 149, 246
BmgT120I GGNCC 3 cut(s) 149, 246, 302
BmrI ACTGGG 1 cut(s) 84
BmsI GCATC 1 cut(s) 70
BmuI ACTGGG 1 cut(s) 84
BsaBI GATNNNNATC 1 cut(s) 84
Bsc4I CCNNNNNNNGG 2 cut(s) 243, 278
Bse1I ACTGG 2 cut(s) 79, 89
Bse8I GATNNNNATC 1 cut(s) 84
BseGI GGATG 2 cut(s) 85, 184
BseJI GATNNNNATC 1 cut(s) 84
BseLI CCNNNNNNNGG 2 cut(s) 243, 278
BseNI ACTGG 2 cut(s) 79, 89
BshFI GGCC 3 cut(s) 282, 291, 303
BslI CCNNNNNNNGG 2 cut(s) 243, 278
BsnI GGCC 3 cut(s) 282, 291, 303
BspANI GGCC 3 cut(s) 282, 291, 303
BspHI TCATGA 1 cut(s) 138
BsrI ACTGG 2 cut(s) 79, 89
Bst4CI ACNGT 3 cut(s) 19, 64, 70
BstF5I GGATG 2 cut(s) 85, 184
BstMWI GCNNNNNNNGC 1 cut(s) 288
BstNSI RCATGY 1 cut(s) 220
BsuRI GGCC 3 cut(s) 282, 291, 303
BtsCI GGATG 2 cut(s) 85, 184
CaiI CAGNNNCTG 1 cut(s) 74
CciI TCATGA 1 cut(s) 138
Cfr13I GGNCC 3 cut(s) 149, 246, 302
CviAII CATG 3 cut(s) 139, 217, 274
CviJI RGCY 3 cut(s) 282, 291, 303
CviKI_1 RGCY 3 cut(s) 282, 291, 303
EaeI YGGCCR 1 cut(s) 280
Eco47I GGWCC 2 cut(s) 149, 246
Eco57I CTGAAG 1 cut(s) 117
EcoO109I RGGNCCY 1 cut(s) 149
FaeI CATG 3 cut(s) 142, 220, 277
FaiI YATR 4 cut(s) 140, 146, 218, 275
FatI CATG 3 cut(s) 138, 216, 273
FokI GGATG 2 cut(s) 92, 191
HaeIII GGCC 3 cut(s) 282, 291, 303
Hin1II CATG 3 cut(s) 142, 220, 277
HincII GTYRAC 1 cut(s) 265
HindII GTYRAC 1 cut(s) 265
HinfI GANTC 1 cut(s) 229
HphI GGTGA 2 cut(s) 76, 121
Hpy166II GTNNAC 1 cut(s) 265
Hpy188I TCNGA 3 cut(s) 122, 223, 243
Hpy188III TCNNGA 2 cut(s) 103, 139
Hpy8I GTNNAC 1 cut(s) 265
HpyAV CCTTC 3 cut(s) 17, 100, 169
HpyCH4III ACNGT 3 cut(s) 19, 64, 70
HpyF10VI GCNNNNNNNGC 1 cut(s) 288
Hsp92II CATG 3 cut(s) 142, 220, 277
LpnPI CCDG 3 cut(s) 60, 102, 176
LweI GCATC 1 cut(s) 70
MaeIII GTNAC 2 cut(s) 64, 70
MboII GAAGA 2 cut(s) 184, 196
MlsI TGGCCA 1 cut(s) 282
MluCI AATT 2 cut(s) 116, 316
MluNI TGGCCA 1 cut(s) 282
MlyI GAGTC 1 cut(s) 238
MnlI CCTC 4 cut(s) 53, 162, 168, 237
Mox20I TGGCCA 1 cut(s) 282
MscI TGGCCA 1 cut(s) 282
MseI TTAA 3 cut(s) 8, 204, 252
Msp20I TGGCCA 1 cut(s) 282
MwoI GCNNNNNNNGC 1 cut(s) 288
NlaIII CATG 3 cut(s) 142, 220, 277
NmuCI GTSAC 1 cut(s) 64
NspI RCATGY 1 cut(s) 220
PagI TCATGA 1 cut(s) 138
PciI ACATGT 1 cut(s) 216
PleI GAGTC 1 cut(s) 237
PpsI GAGTC 1 cut(s) 237
PpuMI RGGWCCY 1 cut(s) 149
PscI ACATGT 1 cut(s) 216
Psp5II RGGWCCY 1 cut(s) 149
PspPI GGNCC 3 cut(s) 149, 246, 302
PspPPI RGGWCCY 1 cut(s) 149
PstNI CAGNNNCTG 1 cut(s) 74
SaqAI TTAA 3 cut(s) 8, 204, 252
Sau96I GGNCC 3 cut(s) 149, 246, 302
SchI GAGTC 1 cut(s) 238
SetI ASST 7 cut(s) 99, 111, 151, 160, 195, 248, 264
SfaNI GCATC 1 cut(s) 70
SfiI GGCCNNNNNGGCC 1 cut(s) 288
SinI GGWCC 2 cut(s) 149, 246
Sse9I AATT 2 cut(s) 116, 316
TaaI ACNGT 3 cut(s) 19, 64, 70
TaqI TCGA 3 cut(s) 35, 45, 320
TasI AATT 2 cut(s) 116, 316
Tru1I TTAA 3 cut(s) 8, 204, 252
Tru9I TTAA 3 cut(s) 8, 204, 252
TseFI GTSAC 1 cut(s) 64
Tsp45I GTSAC 1 cut(s) 64
TspDTI ATGAA 2 cut(s) 17, 290
VpaK11BI GGWCC 2 cut(s) 149, 246
XapI RAATTY 2 cut(s) 116, 316
XceI RCATGY 1 cut(s) 220
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.