Prupe.1G375500_v2.0.a1

Phosphorylates Ins(1,3,4,5,6)P5 at position 2 to form Ins(1,2,3,4,5,6)P6 (InsP6 or phytate)

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Reverse (-)
34055849 .. 34057605
1757 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G375500.1

Sequence Viewer

Length: 336 bp
ATGTCTAAGAAAACTGTAGTGTCAGTGGAACTGCTGTGTTCAAAGTGCAGGAAGAAGGTGATGAAGTTAATAGCAACGGTAGAAGGGATAACTTCCATTGTCCTGGACCCGTCAAAAAATACGGTGACAGTAACTGGGGATGCCGATCCAGTAAAGGTTATCAAGAAGGTAAGAAAATTCAGAAAATCTGCTTCCGTTGTGAGTATAGGTCCTCCACAGAGTGAGAAGAAGGATGAGAAGAAAGACCTTGTCCCTTACCCACCAAAGACATGTCAGAGATGCGATGTCTGGTATGTGATTGCTGAAGATGGTTACAATTATTGTTCCATAATGTAA

Protein Analysis

112

Amino Acids

12.37

Weight (kDa)

9.42

Isoelectric Point (pI)

23.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 140
AcsI RAATTY 1 cut(s) 176
AcuI CTGAAG 1 cut(s) 324
AdeI CACNNNGTG 1 cut(s) 221
AflIII ACRYGT 1 cut(s) 269
AgsI TTSAA 1 cut(s) 42
AjnI CCWGG 1 cut(s) 102
AlwI GGATC 1 cut(s) 140
AlwNI CAGNNNCTG 1 cut(s) 134
ApoI RAATTY 1 cut(s) 176
AspS9I GGNCC 2 cut(s) 106, 209
AsuHPI GGTGA 2 cut(s) 70, 136
AvaII GGWCC 2 cut(s) 106, 209
BccI CCATC 1 cut(s) 302
BciT130I CCWGG 1 cut(s) 104
BfmI CTRYAG 1 cut(s) 15
Bme1390I CCNGG 1 cut(s) 104
Bme18I GGWCC 2 cut(s) 106, 209
BmgT120I GGNCC 2 cut(s) 106, 209
BmiI GGNNCC 1 cut(s) 108
BmrFI CCNGG 1 cut(s) 104
BmrI ACTGGG 1 cut(s) 144
BmsI GCATC 2 cut(s) 130, 269
BmuI ACTGGG 1 cut(s) 144
BsaBI GATNNNNATC 1 cut(s) 144
Bse1I ACTGG 2 cut(s) 139, 149
Bse8I GATNNNNATC 1 cut(s) 144
BseBI CCWGG 1 cut(s) 104
BseGI GGATG 2 cut(s) 145, 238
BseJI GATNNNNATC 1 cut(s) 144
BseNI ACTGG 2 cut(s) 139, 149
BsgI GTGCAG 1 cut(s) 67
BslFI GGGAC 1 cut(s) 236
BsmFI GGGAC 1 cut(s) 236
Bsp143I GATC 1 cut(s) 145
BspLI GGNNCC 1 cut(s) 108
BspPI GGATC 1 cut(s) 140
BsrI ACTGG 2 cut(s) 139, 149
BssMI GATC 1 cut(s) 145
Bst2UI CCWGG 1 cut(s) 104
Bst4CI ACNGT 4 cut(s) 16, 79, 124, 130
BstDEI CTNAG 1 cut(s) 6
BstF5I GGATG 2 cut(s) 145, 238
BstKTI GATC 1 cut(s) 148
BstMBI GATC 1 cut(s) 145
BstNI CCWGG 1 cut(s) 104
BstNSI RCATGY 1 cut(s) 273
BstSCI CCNGG 1 cut(s) 102
BstSFI CTRYAG 1 cut(s) 15
BstXI CCANNNNNNTGG 1 cut(s) 103
BtgZI GCGATG 1 cut(s) 297
BtsCI GGATG 2 cut(s) 145, 238
BtsIMutI CAGTG 1 cut(s) 30
CaiI CAGNNNCTG 1 cut(s) 134
Cfr13I GGNCC 2 cut(s) 106, 209
CviAII CATG 1 cut(s) 270
DdeI CTNAG 1 cut(s) 6
DpnI GATC 1 cut(s) 147
DpnII GATC 1 cut(s) 145
DraIII CACNNNGTG 1 cut(s) 221
Eco47I GGWCC 2 cut(s) 106, 209
Eco57I CTGAAG 1 cut(s) 324
EcoO109I RGGNCCY 1 cut(s) 209
EcoRII CCWGG 1 cut(s) 102
FaeI CATG 1 cut(s) 273
FaiI YATR 4 cut(s) 206, 271, 294, 329
FaqI GGGAC 1 cut(s) 236
FatI CATG 1 cut(s) 269
FokI GGATG 2 cut(s) 152, 245
Hin1II CATG 1 cut(s) 273
HphI GGTGA 2 cut(s) 70, 136
Hpy188I TCNGA 2 cut(s) 182, 276
Hpy188III TCNNGA 1 cut(s) 163
HpyAV CCTTC 4 cut(s) 49, 77, 160, 223
HpyCH4III ACNGT 4 cut(s) 16, 79, 124, 130
HpyCH4V TGCA 1 cut(s) 48
HpyF3I CTNAG 1 cut(s) 6
Hsp92II CATG 1 cut(s) 273
Kzo9I GATC 1 cut(s) 145
LpnPI CCDG 6 cut(s) 34, 89, 116, 120, 162, 274
LweI GCATC 2 cut(s) 130, 269
MaeIII GTNAC 3 cut(s) 124, 130, 311
MalI GATC 1 cut(s) 147
MboI GATC 1 cut(s) 145
MboII GAAGA 4 cut(s) 64, 238, 250, 317
MluCI AATT 2 cut(s) 176, 316
MnlI CCTC 1 cut(s) 222
MseI TTAA 1 cut(s) 68
MspR9I CCNGG 1 cut(s) 104
MvaI CCWGG 1 cut(s) 104
NdeII GATC 1 cut(s) 145
NlaIII CATG 1 cut(s) 273
NlaIV GGNNCC 1 cut(s) 108
NmuCI GTSAC 1 cut(s) 124
NspI RCATGY 1 cut(s) 273
PciI ACATGT 1 cut(s) 269
PflFI GACNNNGTC 1 cut(s) 248
PfoI TCCNGGA 1 cut(s) 102
PpuMI RGGWCCY 1 cut(s) 209
PscI ACATGT 1 cut(s) 269
Psp5II RGGWCCY 1 cut(s) 209
Psp6I CCWGG 1 cut(s) 102
PspGI CCWGG 1 cut(s) 102
PspN4I GGNNCC 1 cut(s) 108
PspPI GGNCC 2 cut(s) 106, 209
PspPPI RGGWCCY 1 cut(s) 209
PstNI CAGNNNCTG 1 cut(s) 134
PsyI GACNNNGTC 1 cut(s) 248
SaqAI TTAA 1 cut(s) 68
Sau3AI GATC 1 cut(s) 145
Sau96I GGNCC 2 cut(s) 106, 209
ScrFI CCNGG 1 cut(s) 104
SetI ASST 5 cut(s) 60, 159, 171, 211, 249
SfaNI GCATC 2 cut(s) 130, 269
SfcI CTRYAG 1 cut(s) 15
SinI GGWCC 2 cut(s) 106, 209
Sse9I AATT 2 cut(s) 176, 316
StyD4I CCNGG 1 cut(s) 102
TaaI ACNGT 4 cut(s) 16, 79, 124, 130
TasI AATT 2 cut(s) 176, 316
Tru1I TTAA 1 cut(s) 68
Tru9I TTAA 1 cut(s) 68
TscAI CASTG 1 cut(s) 30
TseFI GTSAC 1 cut(s) 124
Tsp45I GTSAC 1 cut(s) 124
TspDTI ATGAA 1 cut(s) 77
TspGWI ACGGA 1 cut(s) 184
TspRI CASTG 1 cut(s) 30
Tth111I GACNNNGTC 1 cut(s) 248
VpaK11BI GGWCC 2 cut(s) 106, 209
XapI RAATTY 1 cut(s) 176
XceI RCATGY 1 cut(s) 273
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.