pycom111g02980

Protease Do-like 9

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_111
Physical Location & Seq
Reverse (-)
1786422 .. 1786673
252 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 252 bp
ATGCTTACGGTGAGCGATGATGAGTTCTGGGGGAATTTCACCCCTGGAGTTTGGAGAGTTACCGCACTCCCAGATGCTGTGACTGTTGCGGGCTACCCTATTGGGGGTGACACAATCTCTGTGACAGGTGGTGTTGTTTCACGTATGGAGATACTGTCTTATGATCATGGATCGACTGAGCTTCTAGGACTGCAGGTTTTCTTTTGGGTATTGTCTTCTACGACCATACGTAGTAACCGACTTACGCACTAA

Protein Analysis

84

Amino Acids

9.05

Weight (kDa)

4.69

Isoelectric Point (pI)

25.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 184
AciI CCGC 2 cut(s) 63, 89
AclWI GGATC 1 cut(s) 178
AcsI RAATTY 1 cut(s) 34
AfiI CCNNNNNNNGG 2 cut(s) 103, 104
AjnI CCWGG 1 cut(s) 43
AluBI AGCT 1 cut(s) 181
AluI AGCT 1 cut(s) 181
AlwI GGATC 1 cut(s) 178
AlwNI CAGNNNCTG 1 cut(s) 77
ApoI RAATTY 1 cut(s) 34
AsuHPI GGTGA 3 cut(s) 22, 31, 119
BbsI GAAGAC 1 cut(s) 207
BciT130I CCWGG 1 cut(s) 45
BclI TGATCA 1 cut(s) 163
BfaI CTAG 1 cut(s) 185
BfmI CTRYAG 1 cut(s) 191
BfuAI ACCTGC 1 cut(s) 184
Bme1390I CCNGG 1 cut(s) 45
BmrFI CCNGG 1 cut(s) 45
BmsI GCATC 1 cut(s) 64
BpiI GAAGAC 1 cut(s) 207
BpmI CTGGAG 1 cut(s) 66
BsaAI YACGTR 2 cut(s) 143, 230
BsaJI CCNNGG 1 cut(s) 43
BsaXI ACNNNNNCTCC 2 cut(s) 140, 170
Bsc4I CCNNNNNNNGG 2 cut(s) 103, 104
BseBI CCWGG 1 cut(s) 45
BseDI CCNNGG 1 cut(s) 43
BseLI CCNNNNNNNGG 2 cut(s) 103, 104
BseMII CTCAG 1 cut(s) 168
BslI CCNNNNNNNGG 2 cut(s) 103, 104
Bsp143I GATC 2 cut(s) 163, 170
BspACI CCGC 2 cut(s) 63, 89
BspCNI CTCAG 1 cut(s) 169
BspMAI CTGCAG 1 cut(s) 195
BspMI ACCTGC 1 cut(s) 184
BspPI GGATC 1 cut(s) 178
BssECI CCNNGG 1 cut(s) 43
BssMI GATC 2 cut(s) 163, 170
Bst2UI CCWGG 1 cut(s) 45
Bst4CI ACNGT 3 cut(s) 10, 85, 156
BstBAI YACGTR 2 cut(s) 143, 230
BstC8I GCNNGC 1 cut(s) 91
BstDEI CTNAG 1 cut(s) 177
BstKTI GATC 2 cut(s) 166, 173
BstMBI GATC 2 cut(s) 163, 170
BstNI CCWGG 1 cut(s) 45
BstSCI CCNGG 1 cut(s) 43
BstSFI CTRYAG 1 cut(s) 191
BstSNI TACGTA 1 cut(s) 230
BstV2I GAAGAC 1 cut(s) 207
BtgZI GCGATG 1 cut(s) 30
BveI ACCTGC 1 cut(s) 184
Cac8I GCNNGC 1 cut(s) 91
CaiI CAGNNNCTG 1 cut(s) 77
CviAII CATG 1 cut(s) 167
CviJI RGCY 2 cut(s) 93, 181
CviKI_1 RGCY 2 cut(s) 93, 181
DdeI CTNAG 1 cut(s) 177
DpnI GATC 2 cut(s) 165, 172
DpnII GATC 2 cut(s) 163, 170
Eco105I TACGTA 1 cut(s) 230
EcoRII CCWGG 1 cut(s) 43
FaeI CATG 1 cut(s) 170
FaiI YATR 4 cut(s) 146, 162, 168, 227
FatI CATG 1 cut(s) 166
FauI CCCGC 1 cut(s) 82
FbaI TGATCA 1 cut(s) 163
FspBI CTAG 1 cut(s) 185
GsuI CTGGAG 1 cut(s) 66
Hin1II CATG 1 cut(s) 170
HphI GGTGA 3 cut(s) 22, 31, 119
HpyCH4III ACNGT 3 cut(s) 10, 85, 156
HpyCH4IV ACGT 2 cut(s) 142, 229
HpyCH4V TGCA 1 cut(s) 193
HpyF3I CTNAG 1 cut(s) 177
HpySE526I ACGT 2 cut(s) 142, 229
Hsp92II CATG 1 cut(s) 170
Ksp22I TGATCA 1 cut(s) 163
Kzo9I GATC 2 cut(s) 163, 170
LpnPI CCDG 6 cut(s) 13, 30, 57, 84, 111, 179
LweI GCATC 1 cut(s) 64
MaeI CTAG 1 cut(s) 185
MaeII ACGT 2 cut(s) 142, 229
MaeIII GTNAC 5 cut(s) 58, 79, 107, 121, 233
MalI GATC 2 cut(s) 165, 172
MboI GATC 2 cut(s) 163, 170
MboII GAAGA 1 cut(s) 207
MluCI AATT 1 cut(s) 34
MspR9I CCNGG 1 cut(s) 45
MvaI CCWGG 1 cut(s) 45
NdeII GATC 2 cut(s) 163, 170
NlaIII CATG 1 cut(s) 170
NmuCI GTSAC 3 cut(s) 79, 107, 121
PcsI WCGNNNNNNNCGW 1 cut(s) 235
Ppu21I YACGTR 2 cut(s) 143, 230
Psp6I CCWGG 1 cut(s) 43
PspGI CCWGG 1 cut(s) 43
PstI CTGCAG 1 cut(s) 195
PstNI CAGNNNCTG 1 cut(s) 77
Sau3AI GATC 2 cut(s) 163, 170
ScrFI CCNGG 1 cut(s) 45
SetI ASST 5 cut(s) 130, 145, 183, 198, 232
SfaNI GCATC 1 cut(s) 64
SfcI CTRYAG 1 cut(s) 191
SnaBI TACGTA 1 cut(s) 230
Sse9I AATT 1 cut(s) 34
SsiI CCGC 2 cut(s) 63, 89
SspMI CTAG 1 cut(s) 185
StyD4I CCNGG 1 cut(s) 43
TaaI ACNGT 3 cut(s) 10, 85, 156
TaiI ACGT 2 cut(s) 145, 232
TaqI TCGA 1 cut(s) 173
TasI AATT 1 cut(s) 34
TseFI GTSAC 3 cut(s) 79, 107, 121
Tsp45I GTSAC 3 cut(s) 79, 107, 121
XapI RAATTY 1 cut(s) 34
XspI CTAG 1 cut(s) 185
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.