Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003787.1

Orthogroup ID

OG0001244

Physical Location & Seq

Genomic Coordinates Reverse (-)

47689 .. 50633

Gene Structure 2945 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003787.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1734 bp

atgtatctccaattcatcaatcccacaagcacaaccaccgccctaaatgacaaccttcccatctccaagatagtttcttcattgccgcaacaatcaccacttgttcaccaaaacggtgactcgggtgttgtctcggagccggagccgatggtgcagaggtgggagggtggtggcgggagagtggtgccggcgatggacgcggtggtgaaggtgttttgtgttcatacggagccgaatttctcgttgccgtggcagaggaagaagcagtacagttcgagtagtagtgggtttgtgattaggggcaggagggtcttgaccaatgcgcattctgtggatcatcatacacaggtcaaggtcaagaagcgtggctctgacaccaagtacttggccactgtgttggccattggaaccgagtgtgatattgcaatgcttacggtgagtgatgatgagttctgggaagggatttcacctgtggagtttgggaacttgcctgcgctgcaagatgctgtgactgttgtgggctatcctattgggggtgacacaatctctgtgacgagtggtgttgtgtcacgcatggagatactttcttatgttcatggctccactgagcttctgggaatgcagatagatgctgcaataaactctggaaactccggtgggccggcgtttaatgataagggaaaatgtgtggggattgcattccagtctctcaagcatgaagatgtggaaaatataggctatgtcataccaataccagttattatgcacttcattttggattatgagaagaacgggtcatatacagggttcccaattcttggaattgagtggcagaagatggaaaatcctgatctgcgcatgtcaatggggatgggacctgatcaaaagggtgtgcgaatcagaagaatggagcctacttctccagaatctcttgttctgaaaccatctgatgttattcttagctttgatggggttaatattgctaatgatggcacagttccattcaggcatggagagcgcataggtttcagttaccttgtctcccaaaaatacattggggataatgcgctagtcaaagttctaagaaactcagagacacttgaattcaacataaaactagcaaaacacaaggaactgatcccgtcacacatagagggaaaacctccttcttattacatcattgctggatttgttttcacagctgtatctgttccatatctgcgttctgagtttggaaatatatttgatgttccaatcaaattattggacaagcatttacatgcaatggcacagtctattgatgaacaacttgttgttgtttctcaggtacttgttgctgacattaatattggatatgaggatattgttaacaatcaggtacttgttgctgacattaatattggatatgaggatattgttaacaatcaggttcttgacttcaatggtaagcctgtgaagaacctgaagagcttagccaagatggtcgagaattgtgatgacgagtacctaaagtttagcctagaatataatcagatggttgttctacagacaaaaactgccaaggcagcaacactagatatcctcacaacgcattgcatatcttcgtccatgtctgatgaccttaagactaaagacattatgttacaggaagtagagtctttgtctgatgaccttaagactaagatattagaggaagaacaaatgcttacttctcctttagctgtatctacatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005730 GO:0005737 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008236 GO:0009507 GO:0009536 GO:0016787 GO:0017171 GO:0019538 GO:0031974 GO:0031981 GO:0043170 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0044238 GO:0044422 GO:0044424 GO:0044428 GO:0044444 GO:0044446 GO:0044464 GO:0070011 GO:0070013 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PDZ_2 Trypsin_2

Protein Analysis

577

Amino Acids

63.56

Weight (kDa)

5.18

Isoelectric Point (pI)

46.21

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001244)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G40200
fragaria_vesca	FvH4_5g04990 FvH4_6g50350 FvH4_6g50350 FvH4_6g50350 FvH4_6g50350 FvH4_6g50350 FvH4_6g50350 FvH4_6g50350
malus_domestica	MD06G1178100.v1.1 MD06G1178200.v1.1 MD09G1037000.v1.1 MD09G1037100.v1.1 MD14G1184600.v1.1 MD17G1038400.v1.1 MD17G1038500.v1.1
prunus_persica	Prupe.3G280500_v2.0.a1 Prupe.3G280600_v2.0.a1 Prupe.5G177300_v2.0.a1 Prupe.5G177300_v2.0.a1
pyrus_communis	pycom06g15840 pycom111g02980 pycom14g15360 pycom17g03470
rosa_chinensis	RchiOBHm_Chr1g0327041 RchiOBHm_Chr2g0170661 RchiOBHm_Chr2g0170671 RchiOBHm_Chr7g0194051
rosa_laevigata	RLG00000004221 RLG00000021973 RLG00000021974
rosa_multiflora	Rmu_sc0003787.1_g000010 Rmu_sc0003787.1_g000011 Rmu_sc0009433.1_g000001 Rmu_sc0023958.1_g000001 Rmu_sc0042111.1_g000001
rosa_roxburghii	Rroxscaffold_2G00081130 Rroxscaffold_2G00081140 Rroxscaffold_3G00261590
rosa_rugosa	Rorug02G0550300 Rorug07G0013500
rosa_samantha	Rh2AG623200 Rh2AG623300 Rh2BG633700 Rh2CG602900 Rh2CG603000 Rh2DG646500 Rh7AG140600 Rh7BG141300 Rh7CG144700 Rh7DG142000 Rh7DG324300
rosa_wichuraiana	Rw2G028950 Rw2G051610 Rw2G051620 Rw7G012010

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	2 cut(s)	324, 857
AccB1I	GGYRCC	1 cut(s)	184
AccB7I	CCANNNNNTGG	1 cut(s)	818
AccII	CGCG	1 cut(s)	200
AciI	CCGC	4 cut(s)	39, 86, 174, 200
AclWI	GGATC	2 cut(s)	342, 1132
AcoI	YGGCCR	2 cut(s)	387, 399
AcsI	RAATTY	2 cut(s)	235, 1103
AcuI	CTGAAG	1 cut(s)	1484
AfaI	GTAC	5 cut(s)	269, 383, 1329, 1380, 1505
AfiI	CCNNNNNNNGG	2 cut(s)	533, 818
AflII	CTTAAG	2 cut(s)	1622, 1673
AgsI	TTSAA	3 cut(s)	1103, 1108, 1441
AluBI	AGCT	5 cut(s)	610, 963, 1202, 1470, 1721
AluI	AGCT	5 cut(s)	610, 963, 1202, 1470, 1721
Alw26I	GTCTC	4 cut(s)	136, 711, 1045, 1088
AlwI	GGATC	2 cut(s)	342, 1132
Ama87I	CYCGRG	1 cut(s)	121
AoxI	GGCC	3 cut(s)	387, 399, 659
ApeKI	GCWGC	3 cut(s)	496, 632, 1565
ApoI	RAATTY	2 cut(s)	235, 1103
AseI	ATTAAT	2 cut(s)	1344, 1395
AspLEI	GCGC	5 cut(s)	325, 496, 858, 1020, 1069
AspS9I	GGNCC	2 cut(s)	659, 875
AsuHPI	GGTGA	7 cut(s)	87, 98, 128, 217, 448, 459, 548
AvaI	CYCGRG	1 cut(s)	121
AvaII	GGWCC	1 cut(s)	875
BaeI	ACNNNNGTAYC	2 cut(s)	1188, 1221
BalI	TGGCCA	2 cut(s)	389, 401
BanI	GGYRCC	1 cut(s)	184
BarI	GAAGNNNNNNTAC	2 cut(s)	251, 283
BbvI	GCAGC	3 cut(s)	483, 619, 1577
BceAI	ACGGC	1 cut(s)	232
BclI	TGATCA	1 cut(s)	880
BcoDI	GTCTC	4 cut(s)	136, 711, 1045, 1088
BfaI	CTAG	4 cut(s)	1070, 1118, 1520, 1574
BfmI	CTRYAG	1 cut(s)	1544
BfrI	CTTAAG	2 cut(s)	1622, 1673
BisI	GCNGC	4 cut(s)	86, 497, 633, 1566
BlpI	GCTNAGC	1 cut(s)	1471
BlsI	GCNGC	4 cut(s)	87, 498, 634, 1567
BmcAI	AGTACT	1 cut(s)	383
Bme18I	GGWCC	1 cut(s)	875
BmeT110I	CYCGRG	1 cut(s)	121
BmgT120I	GGNCC	2 cut(s)	659, 875
BmiI	GGNNCC	9 cut(s)	138, 144, 186, 231, 409, 601, 809, 876, 912
BmsI	GCATC	2 cut(s)	493, 619
BpmI	CTGGAG	1 cut(s)	906
Bpu1102I	GCTNAGC	1 cut(s)	1471
BpuEI	CTTGAG	1 cut(s)	695
BsaJI	CCNNGG	2 cut(s)	248, 1560
BsaWI	WCCGGW	1 cut(s)	653
BsaXI	ACNNNNNCTCC	2 cut(s)	1025, 1055
Bsc4I	CCNNNNNNNGG	2 cut(s)	533, 818
Bse118I	RCCGGY	2 cut(s)	187, 661
Bse1I	ACTGG	2 cut(s)	703, 755
Bse3DI	GCAATG	5 cut(s)	80, 432, 1179, 1290, 1591
BseDI	CCNNGG	2 cut(s)	248, 1560
BseGI	GGATG	1 cut(s)	876
BseLI	CCNNNNNNNGG	2 cut(s)	533, 818
BseMI	GCAATG	5 cut(s)	80, 432, 1179, 1290, 1591
BseMII	CTCAG	4 cut(s)	597, 1104, 1218, 1337
BseNI	ACTGG	2 cut(s)	703, 755
BseXI	GCAGC	3 cut(s)	483, 619, 1577
BsgI	GTGCAG	1 cut(s)	173
Bsh1236I	CGCG	1 cut(s)	200
BshFI	GGCC	3 cut(s)	389, 401, 661
BshNI	GGYRCC	1 cut(s)	184
BsiHKCI	CYCGRG	1 cut(s)	121
BsiSI	CCGG	4 cut(s)	140, 188, 654, 662
BslFI	GGGAC	1 cut(s)	888
BslI	CCNNNNNNNGG	2 cut(s)	533, 818
BsmAI	GTCTC	4 cut(s)	136, 711, 1045, 1088
BsmFI	GGGAC	1 cut(s)	888
BsmI	GAATGC	3 cut(s)	325, 624, 698
BsnI	GGCC	3 cut(s)	389, 401, 661
BsoBI	CYCGRG	1 cut(s)	121
Bsp143I	GATC	4 cut(s)	334, 850, 880, 1137
Bsp1720I	GCTNAGC	1 cut(s)	1471
BspACI	CCGC	4 cut(s)	39, 86, 174, 200
BspANI	GGCC	3 cut(s)	389, 401, 661
BspCNI	CTCAG	4 cut(s)	598, 1103, 1219, 1336
BspFNI	CGCG	1 cut(s)	200
BspLI	GGNNCC	9 cut(s)	138, 144, 186, 231, 409, 601, 809, 876, 912
BspPI	GGATC	2 cut(s)	342, 1132
BspQI	GCTCTTC	1 cut(s)	1460
BspT107I	GGYRCC	1 cut(s)	184
BspTI	CTTAAG	2 cut(s)	1622, 1673
BsrDI	GCAATG	5 cut(s)	80, 432, 1179, 1290, 1591
BsrFI	RCCGGY	2 cut(s)	187, 661
BsrI	ACTGG	2 cut(s)	703, 755
BssAI	RCCGGY	2 cut(s)	187, 661
BssECI	CCNNGG	2 cut(s)	248, 1560
BssMI	GATC	4 cut(s)	334, 850, 880, 1137
BssT1I	CCWWGG	1 cut(s)	1560
Bst4CI	ACNGT	7 cut(s)	116, 272, 394, 436, 514, 997, 1293
Bst6I	CTCTTC	1 cut(s)	1460
BstAFI	CTTAAG	2 cut(s)	1622, 1673
BstC8I	GCNNGC	3 cut(s)	189, 492, 663
BstDEI	CTNAG	8 cut(s)	606, 959, 1082, 1090, 1227, 1323, 1471, 1680
BstDSI	CCRYGG	1 cut(s)	248
BstF5I	GGATG	1 cut(s)	876
BstFNI	CGCG	1 cut(s)	200
BstHHI	GCGC	5 cut(s)	325, 496, 858, 1020, 1069
BstKTI	GATC	4 cut(s)	337, 853, 883, 1140
BstMAI	GTCTC	4 cut(s)	136, 711, 1045, 1088
BstMBI	GATC	4 cut(s)	334, 850, 880, 1137
BstMWI	GCNNNNNNNGC	5 cut(s)	151, 197, 496, 1015, 1565
BstNSI	RCATGY	2 cut(s)	862, 1283
BstSFI	CTRYAG	1 cut(s)	1544
BstUI	CGCG	1 cut(s)	200
BstV1I	GCAGC	3 cut(s)	483, 619, 1577
BstXI	CCANNNNNNTGG	2 cut(s)	385, 397
BsuRI	GGCC	3 cut(s)	389, 401, 661
BtgI	CCRYGG	1 cut(s)	248
BtgZI	GCGATG	1 cut(s)	206
BtsCI	GGATG	1 cut(s)	876
BtsIMutI	CAGTG	2 cut(s)	390, 603
Cac8I	GCNNGC	3 cut(s)	189, 492, 663
CfoI	GCGC	5 cut(s)	325, 496, 858, 1020, 1069
Cfr10I	RCCGGY	2 cut(s)	187, 661
Cfr13I	GGNCC	2 cut(s)	659, 875
CseI	GACGC	1 cut(s)	206
Csp6I	GTAC	5 cut(s)	268, 382, 1328, 1379, 1504
CspCI	CAANNNNNGTGG	2 cut(s)	346, 381
CviAII	CATG	7 cut(s)	574, 596, 716, 859, 1010, 1280, 1609
CviQI	GTAC	5 cut(s)	268, 382, 1328, 1379, 1504
DdeI	CTNAG	8 cut(s)	606, 959, 1082, 1090, 1227, 1323, 1471, 1680
DpnI	GATC	4 cut(s)	336, 852, 882, 1139
DpnII	GATC	4 cut(s)	334, 850, 880, 1137
EaeI	YGGCCR	2 cut(s)	387, 399
Eam1104I	CTCTTC	1 cut(s)	1460
EarI	CTCTTC	1 cut(s)	1460
Eco130I	CCWWGG	1 cut(s)	1560
Eco32I	GATATC	1 cut(s)	1579
Eco47I	GGWCC	1 cut(s)	875
Eco57I	CTGAAG	1 cut(s)	1484
Eco88I	CYCGRG	1 cut(s)	121
EcoO109I	RGGNCCY	1 cut(s)	875
EcoRI	GAATTC	1 cut(s)	1103
EcoRV	GATATC	1 cut(s)	1579
EcoT14I	CCWWGG	1 cut(s)	1560
ErhI	CCWWGG	1 cut(s)	1560
FaeI	CATG	7 cut(s)	577, 599, 719, 862, 1013, 1283, 1612
FaqI	GGGAC	1 cut(s)	888
FatI	CATG	7 cut(s)	573, 595, 715, 858, 1009, 1279, 1608
FauI	CCCGC	1 cut(s)	167
FbaI	TGATCA	1 cut(s)	880
Fnu4HI	GCNGC	4 cut(s)	86, 497, 633, 1566
FokI	GGATG	1 cut(s)	883
Fsp4HI	GCNGC	4 cut(s)	86, 497, 633, 1566
FspAI	RTGCGCAY	1 cut(s)	324
FspBI	CTAG	4 cut(s)	1070, 1118, 1520, 1574
FspI	TGCGCA	2 cut(s)	324, 857
GlaI	GCGC	5 cut(s)	324, 495, 857, 1019, 1068
GluI	GCNGC	4 cut(s)	86, 497, 633, 1566
GsuI	CTGGAG	1 cut(s)	906
HaeIII	GGCC	3 cut(s)	389, 401, 661
HapII	CCGG	4 cut(s)	140, 188, 654, 662
HgaI	GACGC	1 cut(s)	206
HhaI	GCGC	5 cut(s)	325, 496, 858, 1020, 1069
Hin1II	CATG	7 cut(s)	577, 599, 719, 862, 1013, 1283, 1612
Hin6I	GCGC	5 cut(s)	323, 494, 856, 1018, 1067
HinP1I	GCGC	5 cut(s)	323, 494, 856, 1018, 1067
HincII	GTYRAC	2 cut(s)	1369, 1420
HindII	GTYRAC	2 cut(s)	1369, 1420
HinfI	GANTC	4 cut(s)	119, 897, 926, 1655
HpaI	GTTAAC	2 cut(s)	1369, 1420
HpaII	CCGG	4 cut(s)	140, 188, 654, 662
HphI	GGTGA	7 cut(s)	87, 98, 128, 217, 448, 459, 548
Hpy166II	GTNNAC	3 cut(s)	106, 1369, 1420
Hpy188III	TCNNGA	7 cut(s)	313, 358, 645, 848, 923, 1433, 1486
Hpy8I	GTNNAC	3 cut(s)	106, 1369, 1420
HpyAV	CCTTC	4 cut(s)	65, 202, 452, 1176
HpyCH4III	ACNGT	7 cut(s)	116, 272, 394, 436, 514, 997, 1293
HpyCH4V	TGCA	9 cut(s)	154, 425, 499, 622, 635, 698, 766, 1283, 1596
HpyF10VI	GCNNNNNNNGC	5 cut(s)	151, 197, 496, 1015, 1565
HpyF3I	CTNAG	8 cut(s)	606, 959, 1082, 1090, 1227, 1323, 1471, 1680
Hsp92II	CATG	7 cut(s)	577, 599, 719, 862, 1013, 1283, 1612
HspAI	GCGC	5 cut(s)	323, 494, 856, 1018, 1067
KroI	GCCGGC	2 cut(s)	187, 661
KroNI	GCCGGC	2 cut(s)	189, 663
Ksp22I	TGATCA	1 cut(s)	880
KspAI	GTTAAC	2 cut(s)	1369, 1420
Kzo9I	GATC	4 cut(s)	334, 850, 880, 1137
LguI	GCTCTTC	1 cut(s)	1460
LmnI	GCTCC	5 cut(s)	136, 142, 229, 605, 910
Lsp1109I	GCAGC	3 cut(s)	483, 619, 1577
LweI	GCATC	2 cut(s)	493, 619
MaeI	CTAG	4 cut(s)	1070, 1118, 1520, 1574
MaeIII	GTNAC	8 cut(s)	116, 508, 536, 550, 567, 1031, 1143, 1641
MalI	GATC	4 cut(s)	336, 852, 882, 1139
MboI	GATC	4 cut(s)	334, 850, 880, 1137
MlsI	TGGCCA	2 cut(s)	389, 401
MluCI	AATT	7 cut(s)	11, 235, 813, 822, 1103, 1259, 1489
MluNI	TGGCCA	2 cut(s)	389, 401
MlyI	GAGTC	2 cut(s)	113, 1664
Mox20I	TGGCCA	2 cut(s)	389, 401
MroNI	GCCGGC	2 cut(s)	187, 661
MscI	TGGCCA	2 cut(s)	389, 401
MseI	TTAA	8 cut(s)	669, 975, 1344, 1368, 1395, 1419, 1623, 1674
MslI	CAYNNNNRTG	3 cut(s)	720, 863, 1278
Msp20I	TGGCCA	2 cut(s)	389, 401
MspA1I	CMGCKG	1 cut(s)	1202
MspCI	CTTAAG	2 cut(s)	1622, 1673
MspI	CCGG	4 cut(s)	140, 188, 654, 662
Mva1269I	GAATGC	3 cut(s)	325, 624, 698
MvnI	CGCG	1 cut(s)	200
MwoI	GCNNNNNNNGC	5 cut(s)	151, 197, 496, 1015, 1565
NaeI	GCCGGC	2 cut(s)	189, 663
NdeII	GATC	4 cut(s)	334, 850, 880, 1137
NgoMIV	GCCGGC	2 cut(s)	187, 661
NlaIII	CATG	7 cut(s)	577, 599, 719, 862, 1013, 1283, 1612
NlaIV	GGNNCC	9 cut(s)	138, 144, 186, 231, 409, 601, 809, 876, 912
NmuCI	GTSAC	6 cut(s)	116, 508, 536, 550, 567, 1143
NsbI	TGCGCA	2 cut(s)	324, 857
NspI	RCATGY	2 cut(s)	862, 1283
PciSI	GCTCTTC	1 cut(s)	1460
PctI	GAATGC	3 cut(s)	325, 624, 698
PdiI	GCCGGC	2 cut(s)	189, 663
PfeI	GAWTC	2 cut(s)	897, 926
PflMI	CCANNNNNTGG	1 cut(s)	818
PkrI	GCNGC	4 cut(s)	87, 498, 634, 1567
PleI	GAGTC	2 cut(s)	113, 1663
PpsI	GAGTC	2 cut(s)	113, 1663
PpuMI	RGGWCCY	1 cut(s)	875
PshBI	ATTAAT	2 cut(s)	1344, 1395
Psp5II	RGGWCCY	1 cut(s)	875
PspN4I	GGNNCC	9 cut(s)	138, 144, 186, 231, 409, 601, 809, 876, 912
PspPI	GGNCC	2 cut(s)	659, 875
PspPPI	RGGWCCY	1 cut(s)	875
PvuII	CAGCTG	1 cut(s)	1202
RsaI	GTAC	5 cut(s)	269, 383, 1329, 1380, 1505
RsaNI	GTAC	5 cut(s)	268, 382, 1328, 1379, 1504
RseI	CAYNNNNRTG	3 cut(s)	720, 863, 1278
SapI	GCTCTTC	1 cut(s)	1460
SaqAI	TTAA	8 cut(s)	669, 975, 1344, 1368, 1395, 1419, 1623, 1674
SatI	GCNGC	4 cut(s)	86, 497, 633, 1566
Sau3AI	GATC	4 cut(s)	334, 850, 880, 1137
Sau96I	GGNCC	2 cut(s)	659, 875
ScaI	AGTACT	1 cut(s)	383
SchI	GAGTC	2 cut(s)	113, 1664
SfaNI	GCATC	2 cut(s)	493, 619
SfcI	CTRYAG	1 cut(s)	1544
SinI	GGWCC	1 cut(s)	875
SmiMI	CAYNNNNRTG	3 cut(s)	720, 863, 1278
SmlI	CTYRAG	3 cut(s)	710, 1622, 1673
SmoI	CTYRAG	3 cut(s)	710, 1622, 1673
Sse9I	AATT	7 cut(s)	11, 235, 813, 822, 1103, 1259, 1489
SsiI	CCGC	4 cut(s)	39, 86, 174, 200
SspI	AATATT	3 cut(s)	979, 1348, 1399
SspMI	CTAG	4 cut(s)	1070, 1118, 1520, 1574
StyI	CCWWGG	1 cut(s)	1560
TaaI	ACNGT	7 cut(s)	116, 272, 394, 436, 514, 997, 1293
TaqI	TCGA	2 cut(s)	275, 1485
TasI	AATT	7 cut(s)	11, 235, 813, 822, 1103, 1259, 1489
TatI	WGTACW	2 cut(s)	267, 381
TauI	GCSGC	1 cut(s)	88
TfiI	GAWTC	2 cut(s)	897, 926
Tru1I	TTAA	8 cut(s)	669, 975, 1344, 1368, 1395, 1419, 1623, 1674
Tru9I	TTAA	8 cut(s)	669, 975, 1344, 1368, 1395, 1419, 1623, 1674
TscAI	CASTG	2 cut(s)	397, 610
TseFI	GTSAC	6 cut(s)	116, 508, 536, 550, 567, 1143
TseI	GCWGC	3 cut(s)	496, 632, 1565
Tsp45I	GTSAC	6 cut(s)	116, 508, 536, 550, 567, 1143
TspDTI	ATGAA	7 cut(s)	4, 69, 212, 584, 732, 760, 1317
TspGWI	ACGGA	1 cut(s)	242
TspRI	CASTG	2 cut(s)	397, 610
Van91I	CCANNNNNTGG	1 cut(s)	818
Vha464I	CTTAAG	2 cut(s)	1622, 1673
VpaK11BI	GGWCC	1 cut(s)	875
VspI	ATTAAT	2 cut(s)	1344, 1395
XapI	RAATTY	2 cut(s)	235, 1103
XceI	RCATGY	2 cut(s)	862, 1283
XcmI	CCANNNNNNNNNTGG	2 cut(s)	610, 1052
XspI	CTAG	4 cut(s)	1070, 1118, 1520, 1574
ZrmI	AGTACT	1 cut(s)	383

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.