Rmu_sc0023958.1_g000001

Protease Do-like 9

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0023958.1
Physical Location & Seq
Reverse (-)
24 .. 510
487 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0023958.1_g000001.1.cds

Sequence Viewer

Length: 384 bp
atgctcacagtgagtgatgatgagttctgggaaggagtttcacctgtggagtttggagagttgccggtgctccaagatgctgtgacggttgtgggctaccctattgggggtgaaacaatctctgtgacgagtggtgtagtgtcacgtatggagatactttcatatgttcatggatcaactgagcttctgggactgcagatagatgctgccataaactctggaaactctggtgggcctgccttcaatgacaaggggacctgtgtgggcattgcttttcagtctcttaaacataaagatgcagaaaatataggctacgttattccaatacctgttatcaagcacttcattacagattacgagaagaatggggcatatacaggttag

Protein Analysis

127

Amino Acids

13.46

Weight (kDa)

4.4

Isoelectric Point (pI)

29.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 181
AfiI CCNNNNNNNGG 2 cut(s) 106, 107
AgsI TTSAA 1 cut(s) 244
AluBI AGCT 1 cut(s) 184
AluI AGCT 1 cut(s) 184
Alw21I GWGCWC 1 cut(s) 72
Alw26I GTCTC 1 cut(s) 285
AlwI GGATC 1 cut(s) 181
AoxI GGCC 1 cut(s) 233
ApeKI GCWGC 1 cut(s) 206
AspS9I GGNCC 2 cut(s) 233, 255
AsuHPI GGTGA 2 cut(s) 33, 122
AvaII GGWCC 1 cut(s) 255
Bbv12I GWGCWC 1 cut(s) 72
BbvI GCAGC 1 cut(s) 193
BcoDI GTCTC 1 cut(s) 285
BfmI CTRYAG 1 cut(s) 194
BisI GCNGC 1 cut(s) 207
BlsI GCNGC 1 cut(s) 208
Bme18I GGWCC 1 cut(s) 255
BmgT120I GGNCC 2 cut(s) 233, 255
BmiI GGNNCC 1 cut(s) 256
BmsI GCATC 3 cut(s) 67, 193, 286
BsaAI YACGTR 1 cut(s) 146
Bsc4I CCNNNNNNNGG 2 cut(s) 106, 107
Bse118I RCCGGY 1 cut(s) 64
Bse3DI GCAATG 1 cut(s) 267
BseLI CCNNNNNNNGG 2 cut(s) 106, 107
BseMI GCAATG 1 cut(s) 267
BseMII CTCAG 1 cut(s) 171
BseXI GCAGC 1 cut(s) 193
BshFI GGCC 1 cut(s) 235
BsiHKAI GWGCWC 1 cut(s) 72
BsiSI CCGG 1 cut(s) 65
BslFI GGGAC 2 cut(s) 204, 268
BslI CCNNNNNNNGG 2 cut(s) 106, 107
BsmAI GTCTC 1 cut(s) 285
BsmFI GGGAC 2 cut(s) 204, 268
BsnI GGCC 1 cut(s) 235
Bsp1286I GDGCHC 1 cut(s) 72
Bsp143I GATC 1 cut(s) 173
BspANI GGCC 1 cut(s) 235
BspCNI CTCAG 1 cut(s) 172
BspLI GGNNCC 1 cut(s) 256
BspMAI CTGCAG 1 cut(s) 198
BspPI GGATC 1 cut(s) 181
BsrDI GCAATG 1 cut(s) 267
BsrFI RCCGGY 1 cut(s) 64
BssAI RCCGGY 1 cut(s) 64
BssMI GATC 1 cut(s) 173
Bst4CI ACNGT 2 cut(s) 10, 88
BstBAI YACGTR 1 cut(s) 146
BstC8I GCNNGC 1 cut(s) 237
BstDEI CTNAG 1 cut(s) 180
BstKTI GATC 1 cut(s) 176
BstMAI GTCTC 1 cut(s) 285
BstMBI GATC 1 cut(s) 173
BstSFI CTRYAG 1 cut(s) 194
BstV1I GCAGC 1 cut(s) 193
BsuRI GGCC 1 cut(s) 235
BtsIMutI CAGTG 1 cut(s) 15
Cac8I GCNNGC 1 cut(s) 237
Cfr10I RCCGGY 1 cut(s) 64
Cfr13I GGNCC 2 cut(s) 233, 255
CviAII CATG 1 cut(s) 170
CviJI RGCY 4 cut(s) 96, 184, 235, 312
CviKI_1 RGCY 4 cut(s) 96, 184, 235, 312
DdeI CTNAG 1 cut(s) 180
DpnI GATC 1 cut(s) 175
DpnII GATC 1 cut(s) 173
Eco47I GGWCC 1 cut(s) 255
EcoO109I RGGNCCY 1 cut(s) 255
FaeI CATG 1 cut(s) 173
FaiI YATR 9 cut(s) 149, 163, 165, 171, 212, 291, 308, 373, 375
FaqI GGGAC 2 cut(s) 204, 268
FatI CATG 1 cut(s) 169
FauNDI CATATG 1 cut(s) 163
Fnu4HI GCNGC 1 cut(s) 207
Fsp4HI GCNGC 1 cut(s) 207
GluI GCNGC 1 cut(s) 207
HaeIII GGCC 1 cut(s) 235
HapII CCGG 1 cut(s) 65
Hin1II CATG 1 cut(s) 173
HpaII CCGG 1 cut(s) 65
HphI GGTGA 2 cut(s) 33, 122
Hpy188III TCNNGA 1 cut(s) 219
HpyAV CCTTC 2 cut(s) 26, 250
HpyCH4III ACNGT 2 cut(s) 10, 88
HpyCH4IV ACGT 2 cut(s) 145, 315
HpyCH4V TGCA 2 cut(s) 196, 299
HpyF3I CTNAG 1 cut(s) 180
HpySE526I ACGT 2 cut(s) 145, 315
Hsp92II CATG 1 cut(s) 173
Kzo9I GATC 1 cut(s) 173
LmnI GCTCC 1 cut(s) 75
Lsp1109I GCAGC 1 cut(s) 193
LweI GCATC 3 cut(s) 67, 193, 286
MaeII ACGT 2 cut(s) 145, 315
MaeIII GTNAC 3 cut(s) 82, 124, 141
MalI GATC 1 cut(s) 175
MboI GATC 1 cut(s) 173
MboII GAAGA 1 cut(s) 373
MhlI GDGCHC 1 cut(s) 72
MseI TTAA 1 cut(s) 285
MslI CAYNNNNRTG 1 cut(s) 294
MspI CCGG 1 cut(s) 65
NdeI CATATG 1 cut(s) 163
NdeII GATC 1 cut(s) 173
NlaIII CATG 1 cut(s) 173
NlaIV GGNNCC 1 cut(s) 256
NmuCI GTSAC 3 cut(s) 82, 124, 141
PkrI GCNGC 1 cut(s) 208
Ppu21I YACGTR 1 cut(s) 146
PpuMI RGGWCCY 1 cut(s) 255
Psp5II RGGWCCY 1 cut(s) 255
PspN4I GGNNCC 1 cut(s) 256
PspPI GGNCC 2 cut(s) 233, 255
PspPPI RGGWCCY 1 cut(s) 255
PstI CTGCAG 1 cut(s) 198
RseI CAYNNNNRTG 1 cut(s) 294
SaqAI TTAA 1 cut(s) 285
SatI GCNGC 1 cut(s) 207
Sau3AI GATC 1 cut(s) 173
Sau96I GGNCC 2 cut(s) 233, 255
SduI GDGCHC 1 cut(s) 72
SetI ASST 7 cut(s) 46, 148, 186, 260, 318, 331, 382
SfaNI GCATC 3 cut(s) 67, 193, 286
SfcI CTRYAG 1 cut(s) 194
SinI GGWCC 1 cut(s) 255
SmiMI CAYNNNNRTG 1 cut(s) 294
TaaI ACNGT 2 cut(s) 10, 88
TaiI ACGT 2 cut(s) 148, 318
Tru1I TTAA 1 cut(s) 285
Tru9I TTAA 1 cut(s) 285
TscAI CASTG 1 cut(s) 15
TseFI GTSAC 3 cut(s) 82, 124, 141
TseI GCWGC 1 cut(s) 206
Tsp45I GTSAC 3 cut(s) 82, 124, 141
TspDTI ATGAA 3 cut(s) 150, 158, 334
TspRI CASTG 1 cut(s) 15
VpaK11BI GGWCC 1 cut(s) 255
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.