RchiOBHm_Chr1g0346781

Choline-phosphate cytidylyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0001730
Physical Location & Seq
Reverse (-)
39332844 .. 39334159
1316 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ57300

Sequence Viewer

Length: 486 bp
ATGGGGTTTCCTAACACCTATTTGCTCGTTGGTGTTTGCAATGATGCTACCACTCACAAGTTTAAAGGGAAAATTGTAATGACAGAGTCCGAACGATATGTATCTCTTCGCCATTGCAAGTGGGTGGATGAAGTCATTCCTGATGCACCCTGGGTAGTCAATGAAGAATTTCTTGACAAGCATAATATTGACTATATAGCCCATGACTCTCTCCCTTATGCTGATGCTAGTGGGCTGGAAAGGATGTATACGAATTTGTTTAAGGAGACAAAACGAACTGAGGGGATATCGACATCGGACATTATAATGAGGATTGTAAAAGATTATAACCAATATGTGTTGTGTAACTTGGATCGTGGTATACTAGAAAAGAGCTTGGCATTAGAAAAACGATTGAGGGTGAACATGAGGTTGAAAAAGTTACAGGAGAAAGTGAAGGAACATCAAGAAAAAGTAGGAGAAACGGTATGTCCATGTTGTTATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00440 ko00564 ko01100 ko05231 map00440 map00564 map01100 map05231
Pfam Domains
Protein Families
CTP_transf_like

Protein Analysis

161

Amino Acids

18.76

Weight (kDa)

6.95

Isoelectric Point (pI)

24.21

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CTP_transf_like PF01467 5 - 103 3.2e-16 Cytidylyltransferase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 305, 327
AccI GTMKAC 2 cut(s) 248, 361
AclWI GGATC 1 cut(s) 360
AcsI RAATTY 2 cut(s) 167, 253
AgsI TTSAA 1 cut(s) 415
AjnI CCWGG 1 cut(s) 149
AluBI AGCT 1 cut(s) 375
AluI AGCT 1 cut(s) 375
Alw26I GTCTC 1 cut(s) 260
AlwI GGATC 1 cut(s) 360
ApoI RAATTY 2 cut(s) 167, 253
Asp700I GAANNNNTTC 2 cut(s) 135, 168
AsuHPI GGTGA 1 cut(s) 412
BciT130I CCWGG 1 cut(s) 151
BcoDI GTCTC 1 cut(s) 260
BfaI CTAG 2 cut(s) 228, 365
Bme1390I CCNGG 1 cut(s) 151
BmrFI CCNGG 1 cut(s) 151
BmsI GCATC 3 cut(s) 34, 133, 214
BsaBI GATNNNNATC 1 cut(s) 100
BsaJI CCNNGG 2 cut(s) 149, 150
BsaXI ACNNNNNCTCC 2 cut(s) 450, 480
Bse3DI GCAATG 2 cut(s) 46, 112
Bse8I GATNNNNATC 1 cut(s) 100
BseBI CCWGG 1 cut(s) 151
BseDI CCNNGG 2 cut(s) 149, 150
BseGI GGATG 2 cut(s) 133, 249
BseJI GATNNNNATC 1 cut(s) 100
BseMI GCAATG 2 cut(s) 46, 112
BseMII CTCAG 1 cut(s) 270
BsmAI GTCTC 1 cut(s) 260
Bsp143I GATC 1 cut(s) 352
BspCNI CTCAG 1 cut(s) 271
BspPI GGATC 1 cut(s) 360
BsrDI GCAATG 2 cut(s) 46, 112
BssECI CCNNGG 2 cut(s) 149, 150
BssMI GATC 1 cut(s) 352
BssNAI GTATAC 2 cut(s) 249, 362
Bst1107I GTATAC 2 cut(s) 249, 362
Bst2UI CCWGG 1 cut(s) 151
Bst4CI ACNGT 1 cut(s) 466
Bst6I CTCTTC 1 cut(s) 111
BstDEI CTNAG 1 cut(s) 279
BstF5I GGATG 2 cut(s) 133, 249
BstKTI GATC 1 cut(s) 355
BstMAI GTCTC 1 cut(s) 260
BstMBI GATC 1 cut(s) 352
BstNI CCWGG 1 cut(s) 151
BstSCI CCNGG 1 cut(s) 149
BstZ17I GTATAC 2 cut(s) 249, 362
BtsCI GGATG 2 cut(s) 133, 249
CviAII CATG 3 cut(s) 203, 406, 474
CviJI RGCY 3 cut(s) 200, 235, 375
CviKI_1 RGCY 3 cut(s) 200, 235, 375
DdeI CTNAG 1 cut(s) 279
DpnI GATC 1 cut(s) 354
DpnII GATC 1 cut(s) 352
DraI TTTAAA 1 cut(s) 64
Eam1104I CTCTTC 1 cut(s) 111
EarI CTCTTC 1 cut(s) 111
Eco32I GATATC 1 cut(s) 288
EcoRII CCWGG 1 cut(s) 149
EcoRV GATATC 1 cut(s) 288
FaeI CATG 3 cut(s) 206, 409, 477
FalI AAGNNNNNCTT 2 cut(s) 156, 188
FatI CATG 3 cut(s) 202, 405, 473
FblI GTMKAC 2 cut(s) 248, 361
FokI GGATG 2 cut(s) 140, 256
FspBI CTAG 2 cut(s) 228, 365
Hin1II CATG 3 cut(s) 206, 409, 477
HinfI GANTC 2 cut(s) 86, 206
HphI GGTGA 1 cut(s) 412
Hpy166II GTNNAC 3 cut(s) 249, 362, 403
Hpy188I TCNGA 2 cut(s) 91, 298
Hpy188III TCNNGA 3 cut(s) 140, 173, 446
Hpy8I GTNNAC 3 cut(s) 249, 362, 403
HpyAV CCTTC 1 cut(s) 430
HpyCH4III ACNGT 1 cut(s) 466
HpyCH4V TGCA 3 cut(s) 39, 117, 146
HpyF3I CTNAG 1 cut(s) 279
Hsp92II CATG 3 cut(s) 206, 409, 477
Kzo9I GATC 1 cut(s) 352
LpnPI CCDG 5 cut(s) 136, 153, 163, 221, 410
LweI GCATC 3 cut(s) 34, 133, 214
MaeI CTAG 2 cut(s) 228, 365
MaeIII GTNAC 2 cut(s) 344, 420
MalI GATC 1 cut(s) 354
MboI GATC 1 cut(s) 352
MboII GAAGA 2 cut(s) 98, 176
MluCI AATT 3 cut(s) 72, 167, 253
MlyI GAGTC 2 cut(s) 95, 200
MnlI CCTC 4 cut(s) 274, 303, 390, 402
MroXI GAANNNNTTC 2 cut(s) 135, 168
MseI TTAA 2 cut(s) 63, 261
MslI CAYNNNNRTG 1 cut(s) 305
MspR9I CCNGG 1 cut(s) 151
MvaI CCWGG 1 cut(s) 151
NdeII GATC 1 cut(s) 352
NlaIII CATG 3 cut(s) 206, 409, 477
PasI CCCWGGG 1 cut(s) 150
PdmI GAANNNNTTC 2 cut(s) 135, 168
PflFI GACNNNGTC 1 cut(s) 85
PleI GAGTC 2 cut(s) 94, 200
PpsI GAGTC 2 cut(s) 94, 200
PsiI TTATAA 2 cut(s) 305, 327
Psp6I CCWGG 1 cut(s) 149
PspGI CCWGG 1 cut(s) 149
PsyI GACNNNGTC 1 cut(s) 85
RseI CAYNNNNRTG 1 cut(s) 305
SaqAI TTAA 2 cut(s) 63, 261
Sau3AI GATC 1 cut(s) 352
SchI GAGTC 2 cut(s) 95, 200
ScrFI CCNGG 1 cut(s) 151
SetI ASST 3 cut(s) 20, 377, 413
SfaNI GCATC 3 cut(s) 34, 133, 214
SmiMI CAYNNNNRTG 1 cut(s) 305
Sse9I AATT 3 cut(s) 72, 167, 253
SspI AATATT 1 cut(s) 187
SspMI CTAG 2 cut(s) 228, 365
StyD4I CCNGG 1 cut(s) 149
TaaI ACNGT 1 cut(s) 466
TaqI TCGA 1 cut(s) 290
TasI AATT 3 cut(s) 72, 167, 253
Tru1I TTAA 2 cut(s) 63, 261
Tru9I TTAA 2 cut(s) 63, 261
TspDTI ATGAA 2 cut(s) 144, 177
Tth111I GACNNNGTC 1 cut(s) 85
XapI RAATTY 2 cut(s) 167, 253
XmiI GTMKAC 2 cut(s) 248, 361
XmnI GAANNNNTTC 2 cut(s) 135, 168
XspI CTAG 2 cut(s) 228, 365
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.