Rh1CG238600

Choline-phosphate cytidylyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0001730
Physical Location & Seq
Reverse (-)
49705218 .. 49706822
1605 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG238600.1

Sequence Viewer

Length: 477 bp
ATGTCAGCTTCAATGAAAGAATTTGATTCAACTCGGTGGGTGCTCGACTCCAACCAGCTCGGTAAGCTTCTCTCTATCCTCAATCTGTTTGAACTCTTAACTCCGTTTCCTAACACCTATTTGCTCGTTGGTGTTTGCAATGATGCTACCACTCACAAGTTTAAAGGGAAAACTGTTATGACGGAGTCCGAACGGTGGGTGGATGAAGTCATTCCTGATGCACCCTGGGTAGTCAACGAAGAATTTCTTGACAAGCATAATATTGACTATATAGCCCATGACTCTCTCCCTTATGCTGATGCTAGTAGGGCTAGAAAGGATGTATATGAATTTGTCAAAGCCGTTGGCAGGTTTAAGGAGACAAAAAGAACTGAGGGGATATCGACATCGAACATTATAATGAGGATTGTAAAAGATTATAACCAGTATGTGTTGCGTAACTTGGATCGTGGTATACTAGAAAAGAGCAAACAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00440 ko00564 ko01100 ko05231 map00440 map00564 map01100 map05231
Pfam Domains
Protein Families
CTP_transf_like

Protein Analysis

158

Amino Acids

18.28

Weight (kDa)

6.31

Isoelectric Point (pI)

38.78

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CTP_transf_like PF01467 36 - 134 7.5e-14 Cytidylyltransferase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 398, 420
Acc36I ACCTGC 1 cut(s) 339
AccI GTMKAC 1 cut(s) 454
AclWI GGATC 1 cut(s) 453
AcsI RAATTY 3 cut(s) 20, 242, 329
AfiI CCNNNNNNNGG 2 cut(s) 195, 348
AgsI TTSAA 3 cut(s) 12, 30, 92
AjnI CCWGG 1 cut(s) 224
AluBI AGCT 3 cut(s) 8, 58, 67
AluI AGCT 3 cut(s) 8, 58, 67
Alw21I GWGCWC 1 cut(s) 45
Alw26I GTCTC 1 cut(s) 353
AlwI GGATC 1 cut(s) 453
ApoI RAATTY 3 cut(s) 20, 242, 329
Asp700I GAANNNNTTC 2 cut(s) 210, 243
Bbv12I GWGCWC 1 cut(s) 45
BceAI ACGGC 1 cut(s) 326
BciT130I CCWGG 1 cut(s) 226
BcoDI GTCTC 1 cut(s) 353
BfaI CTAG 3 cut(s) 303, 312, 458
BfuAI ACCTGC 1 cut(s) 339
Bme1390I CCNGG 1 cut(s) 226
BmrFI CCNGG 1 cut(s) 226
BmsI GCATC 3 cut(s) 133, 208, 289
BsaJI CCNNGG 2 cut(s) 224, 225
Bsc4I CCNNNNNNNGG 2 cut(s) 195, 348
Bse1I ACTGG 1 cut(s) 424
Bse3DI GCAATG 1 cut(s) 145
BseBI CCWGG 1 cut(s) 226
BseDI CCNNGG 2 cut(s) 224, 225
BseGI GGATG 2 cut(s) 208, 325
BseLI CCNNNNNNNGG 2 cut(s) 195, 348
BseMI GCAATG 1 cut(s) 145
BseMII CTCAG 1 cut(s) 363
BseNI ACTGG 1 cut(s) 424
BsiHKAI GWGCWC 1 cut(s) 45
BslI CCNNNNNNNGG 2 cut(s) 195, 348
BsmAI GTCTC 1 cut(s) 353
Bsp1286I GDGCHC 1 cut(s) 45
Bsp143I GATC 1 cut(s) 445
BspCNI CTCAG 1 cut(s) 364
BspMI ACCTGC 1 cut(s) 339
BspPI GGATC 1 cut(s) 453
BsrDI GCAATG 1 cut(s) 145
BsrI ACTGG 1 cut(s) 424
BssECI CCNNGG 2 cut(s) 224, 225
BssMI GATC 1 cut(s) 445
BssNAI GTATAC 1 cut(s) 455
Bst1107I GTATAC 1 cut(s) 455
Bst2UI CCWGG 1 cut(s) 226
Bst4CI ACNGT 3 cut(s) 175, 195, 474
BstDEI CTNAG 1 cut(s) 372
BstF5I GGATG 2 cut(s) 208, 325
BstKTI GATC 1 cut(s) 448
BstMAI GTCTC 1 cut(s) 353
BstMBI GATC 1 cut(s) 445
BstMWI GCNNNNNNNGC 2 cut(s) 64, 308
BstNI CCWGG 1 cut(s) 226
BstSCI CCNGG 1 cut(s) 224
BstZ17I GTATAC 1 cut(s) 455
BtsCI GGATG 2 cut(s) 208, 325
BveI ACCTGC 1 cut(s) 339
CviAII CATG 1 cut(s) 278
CviJI RGCY 6 cut(s) 8, 58, 67, 275, 311, 341
CviKI_1 RGCY 6 cut(s) 8, 58, 67, 275, 311, 341
DdeI CTNAG 1 cut(s) 372
DpnI GATC 1 cut(s) 447
DpnII GATC 1 cut(s) 445
DraI TTTAAA 1 cut(s) 163
Eco32I GATATC 1 cut(s) 381
EcoRII CCWGG 1 cut(s) 224
EcoRV GATATC 1 cut(s) 381
FaeI CATG 1 cut(s) 281
FalI AAGNNNNNCTT 2 cut(s) 231, 263
FatI CATG 1 cut(s) 277
FblI GTMKAC 1 cut(s) 454
FokI GGATG 2 cut(s) 215, 332
FspBI CTAG 3 cut(s) 303, 312, 458
Hin1II CATG 1 cut(s) 281
HincII GTYRAC 1 cut(s) 235
HindII GTYRAC 1 cut(s) 235
HindIII AAGCTT 1 cut(s) 65
HinfI GANTC 4 cut(s) 26, 47, 185, 281
Hpy166II GTNNAC 2 cut(s) 235, 455
Hpy188I TCNGA 1 cut(s) 190
Hpy188III TCNNGA 2 cut(s) 215, 248
Hpy8I GTNNAC 2 cut(s) 235, 455
HpyCH4III ACNGT 3 cut(s) 175, 195, 474
HpyCH4V TGCA 2 cut(s) 138, 221
HpyF10VI GCNNNNNNNGC 2 cut(s) 64, 308
HpyF3I CTNAG 1 cut(s) 372
Hsp92II CATG 1 cut(s) 281
Kzo9I GATC 1 cut(s) 445
LpnPI CCDG 6 cut(s) 68, 211, 228, 238, 334, 437
LweI GCATC 3 cut(s) 133, 208, 289
MaeI CTAG 3 cut(s) 303, 312, 458
MaeIII GTNAC 1 cut(s) 437
MalI GATC 1 cut(s) 447
MboI GATC 1 cut(s) 445
MboII GAAGA 1 cut(s) 251
MhlI GDGCHC 1 cut(s) 45
MluCI AATT 3 cut(s) 20, 242, 329
MlyI GAGTC 3 cut(s) 41, 194, 275
MmeI TCCRAC 1 cut(s) 75
MnlI CCTC 3 cut(s) 89, 367, 396
MroXI GAANNNNTTC 2 cut(s) 210, 243
MseI TTAA 3 cut(s) 98, 162, 354
MslI CAYNNNNRTG 1 cut(s) 398
MspR9I CCNGG 1 cut(s) 226
MvaI CCWGG 1 cut(s) 226
MwoI GCNNNNNNNGC 2 cut(s) 64, 308
NdeII GATC 1 cut(s) 445
NlaIII CATG 1 cut(s) 281
PasI CCCWGGG 1 cut(s) 225
PdmI GAANNNNTTC 2 cut(s) 210, 243
PfeI GAWTC 1 cut(s) 26
PflFI GACNNNGTC 1 cut(s) 184
PleI GAGTC 3 cut(s) 41, 193, 275
PpsI GAGTC 3 cut(s) 41, 193, 275
PsiI TTATAA 2 cut(s) 398, 420
Psp6I CCWGG 1 cut(s) 224
PspGI CCWGG 1 cut(s) 224
PsyI GACNNNGTC 1 cut(s) 184
RseI CAYNNNNRTG 1 cut(s) 398
SaqAI TTAA 3 cut(s) 98, 162, 354
Sau3AI GATC 1 cut(s) 445
SchI GAGTC 3 cut(s) 41, 194, 275
ScrFI CCNGG 1 cut(s) 226
SduI GDGCHC 1 cut(s) 45
SetI ASST 5 cut(s) 10, 60, 69, 119, 353
SfaNI GCATC 3 cut(s) 133, 208, 289
SmiMI CAYNNNNRTG 1 cut(s) 398
Sse9I AATT 3 cut(s) 20, 242, 329
SspI AATATT 1 cut(s) 262
SspMI CTAG 3 cut(s) 303, 312, 458
StyD4I CCNGG 1 cut(s) 224
TaaI ACNGT 3 cut(s) 175, 195, 474
TaqI TCGA 3 cut(s) 45, 383, 389
TasI AATT 3 cut(s) 20, 242, 329
TfiI GAWTC 1 cut(s) 26
Tru1I TTAA 3 cut(s) 98, 162, 354
Tru9I TTAA 3 cut(s) 98, 162, 354
TspDTI ATGAA 3 cut(s) 29, 219, 342
TspGWI ACGGA 2 cut(s) 93, 197
Tth111I GACNNNGTC 1 cut(s) 184
XapI RAATTY 3 cut(s) 20, 242, 329
XmiI GTMKAC 1 cut(s) 454
XmnI GAANNNNTTC 2 cut(s) 210, 243
XspI CTAG 3 cut(s) 303, 312, 458
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.