RchiOBHm_Chr1g0373361

Pentatricopeptide repeat-containing protein At5g48730

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
61641427 .. 61641834
408 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ59725

Sequence Viewer

Length: 408 bp
ATGCTAGGAAAATGTAAACAACCAGAAAAAGCTGAGGTGCTTTTTCAAGCTATGATTGACGAAGGCTGTGGTGTCAGCCATGAACCTTATACTGCTCTTATATCTGCCTATGGTAGGAGCAGTCTCTTTGACAAAGCATTTTCCCTCCTTGAGCAGATGAAGAATACTCCTGATTGCCAGCCTGACGTCCATACCTATTCTATCCTCATAAAATCTTGCCTGCATGTTTTTGCACATGACAAAGTACAGGCTCTGCTTTCAGATATGGAAATTCAGCACATTAGACCCAACACCATCACATACAATACCCTGATAGATGCTTACGGAAATCTAAAAAGTATTGCCCACTTATCCTTCCTATCCAAAATTTTGAATGCTATTTTAGTTGCTGTGAATAATCTACTGTAA

Protein Analysis

135

Amino Acids

15.04

Weight (kDa)

6.27

Isoelectric Point (pI)

26.2

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_2 PF13041 30 - 74 3e-12 PPR repeat family
PPR PF01535 30 - 54 2.1e-06 PPR repeat
PPR_3 PF13812 58 - 110 9.3e-09 Pentatricopeptide repeat domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 189
AcsI RAATTY 2 cut(s) 270, 366
AcyI GRCGYC 1 cut(s) 186
AfaI GTAC 1 cut(s) 246
AfiI CCNNNNNNNGG 1 cut(s) 114
AgsI TTSAA 2 cut(s) 47, 373
AluBI AGCT 2 cut(s) 32, 50
AluI AGCT 2 cut(s) 32, 50
Alw26I GTCTC 1 cut(s) 128
AlwNI CAGNNNCTG 1 cut(s) 253
ApoI RAATTY 2 cut(s) 270, 366
BbvCI CCTCAGC 1 cut(s) 33
BccI CCATC 1 cut(s) 302
BcoDI GTCTC 1 cut(s) 128
BfaI CTAG 1 cut(s) 5
BmsI GCATC 1 cut(s) 307
Bpu10I CCTNAGC 1 cut(s) 33
BpuEI CTTGAG 1 cut(s) 170
BsaHI GRCGYC 1 cut(s) 186
Bsc4I CCNNNNNNNGG 1 cut(s) 114
BseLI CCNNNNNNNGG 1 cut(s) 114
BseMII CTCAG 1 cut(s) 24
BslI CCNNNNNNNGG 1 cut(s) 114
BsmAI GTCTC 1 cut(s) 128
BsmI GAATGC 1 cut(s) 379
BspCNI CTCAG 1 cut(s) 25
BssNI GRCGYC 1 cut(s) 186
Bst4CI ACNGT 1 cut(s) 405
BstACI GRCGYC 1 cut(s) 186
BstC8I GCNNGC 2 cut(s) 179, 221
BstDEI CTNAG 1 cut(s) 33
BstENI CCTNNNNNAGG 1 cut(s) 112
BstMAI GTCTC 1 cut(s) 128
BstNSI RCATGY 1 cut(s) 227
Cac8I GCNNGC 2 cut(s) 179, 221
CaiI CAGNNNCTG 1 cut(s) 253
Csp6I GTAC 1 cut(s) 245
CviAII CATG 3 cut(s) 80, 224, 236
CviJI RGCY 6 cut(s) 32, 50, 66, 78, 181, 251
CviKI_1 RGCY 6 cut(s) 32, 50, 66, 78, 181, 251
CviQI GTAC 1 cut(s) 245
DdeI CTNAG 1 cut(s) 33
EcoNI CCTNNNNNAGG 1 cut(s) 112
FaeI CATG 3 cut(s) 83, 227, 239
FatI CATG 3 cut(s) 79, 223, 235
FspBI CTAG 1 cut(s) 5
Hin1I GRCGYC 1 cut(s) 186
Hin1II CATG 3 cut(s) 83, 227, 239
Hpy166II GTNNAC 1 cut(s) 17
Hpy188I TCNGA 1 cut(s) 262
Hpy188III TCNNGA 1 cut(s) 170
Hpy8I GTNNAC 1 cut(s) 17
HpyAV CCTTC 2 cut(s) 56, 364
HpyCH4III ACNGT 1 cut(s) 405
HpyCH4IV ACGT 1 cut(s) 186
HpyCH4V TGCA 2 cut(s) 223, 233
HpyF3I CTNAG 1 cut(s) 33
HpySE526I ACGT 1 cut(s) 186
Hsp92I GRCGYC 1 cut(s) 186
Hsp92II CATG 3 cut(s) 83, 227, 239
LmnI GCTCC 1 cut(s) 117
LpnPI CCDG 7 cut(s) 36, 183, 191, 195, 233, 233, 323
LweI GCATC 1 cut(s) 307
MaeI CTAG 1 cut(s) 5
MaeII ACGT 1 cut(s) 186
MboII GAAGA 1 cut(s) 172
MluCI AATT 2 cut(s) 270, 366
MnlI CCTC 3 cut(s) 28, 155, 215
Mva1269I GAATGC 1 cut(s) 379
NlaIII CATG 3 cut(s) 83, 227, 239
NspI RCATGY 1 cut(s) 227
PctI GAATGC 1 cut(s) 379
PstNI CAGNNNCTG 1 cut(s) 253
RsaI GTAC 1 cut(s) 246
RsaNI GTAC 1 cut(s) 245
SetI ASST 6 cut(s) 34, 39, 52, 88, 189, 197
SfaNI GCATC 1 cut(s) 307
SmlI CTYRAG 1 cut(s) 149
SmoI CTYRAG 1 cut(s) 149
Sse9I AATT 2 cut(s) 270, 366
SspMI CTAG 1 cut(s) 5
TaaI ACNGT 1 cut(s) 405
TaiI ACGT 1 cut(s) 189
TasI AATT 2 cut(s) 270, 366
TatI WGTACW 1 cut(s) 244
TspDTI ATGAA 2 cut(s) 96, 173
TspGWI ACGGA 1 cut(s) 339
XagI CCTNNNNNAGG 1 cut(s) 112
XapI RAATTY 2 cut(s) 270, 366
XceI RCATGY 1 cut(s) 227
XspI CTAG 1 cut(s) 5
ZraI GACGTC 1 cut(s) 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.