Rmu_sc0001565.1_g000030

Pentatricopeptide repeat-containing protein At5g48730

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001565.1
Physical Location & Seq
Reverse (-)
131519 .. 131824
306 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001565.1_g000030.1.cds

Sequence Viewer

Length: 306 bp
atgctaggaaaatgtaaacaaccagaaaaagctgaggagctttttcaagctatgattgacgaaggctgtggtgtcagccatgaaccttatactgctcttatatctgcctatggtaggagcagtctctttgacaaagcattttccctccttgagcagatgaagaatactcctgattgccatcctgacgtccatacctattctatcctcataaaatcttgcctgcaggtttttgcatatgacaaagtacaggctttgctttcagatatggtaggctctgctttcagatatggaaattcagcacattag

Protein Analysis

101

Amino Acids

11.22

Weight (kDa)

5.71

Isoelectric Point (pI)

32.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 189
Acc36I ACCTGC 1 cut(s) 214
AcsI RAATTY 1 cut(s) 292
AcyI GRCGYC 1 cut(s) 186
AfaI GTAC 1 cut(s) 246
AfiI CCNNNNNNNGG 1 cut(s) 114
AgsI TTSAA 1 cut(s) 47
AluBI AGCT 3 cut(s) 32, 40, 50
AluI AGCT 3 cut(s) 32, 40, 50
Alw26I GTCTC 1 cut(s) 128
ApoI RAATTY 1 cut(s) 292
BbvCI CCTCAGC 1 cut(s) 33
BccI CCATC 1 cut(s) 186
BcoDI GTCTC 1 cut(s) 128
BfaI CTAG 1 cut(s) 5
BfmI CTRYAG 1 cut(s) 221
BfuAI ACCTGC 1 cut(s) 214
Bpu10I CCTNAGC 1 cut(s) 33
BpuEI CTTGAG 1 cut(s) 170
BsaBI GATNNNNATC 1 cut(s) 177
BsaHI GRCGYC 1 cut(s) 186
Bsc4I CCNNNNNNNGG 1 cut(s) 114
Bse8I GATNNNNATC 1 cut(s) 177
BseGI GGATG 1 cut(s) 178
BseJI GATNNNNATC 1 cut(s) 177
BseLI CCNNNNNNNGG 1 cut(s) 114
BseMII CTCAG 1 cut(s) 24
BseRI GAGGAG 1 cut(s) 50
BslI CCNNNNNNNGG 1 cut(s) 114
BsmAI GTCTC 1 cut(s) 128
BspCNI CTCAG 1 cut(s) 25
BspMAI CTGCAG 1 cut(s) 225
BspMI ACCTGC 1 cut(s) 214
BssNI GRCGYC 1 cut(s) 186
BstACI GRCGYC 1 cut(s) 186
BstC8I GCNNGC 1 cut(s) 221
BstDEI CTNAG 1 cut(s) 33
BstENI CCTNNNNNAGG 1 cut(s) 112
BstF5I GGATG 1 cut(s) 178
BstMAI GTCTC 1 cut(s) 128
BstSFI CTRYAG 1 cut(s) 221
BtsCI GGATG 1 cut(s) 178
BveI ACCTGC 1 cut(s) 214
Cac8I GCNNGC 1 cut(s) 221
Csp6I GTAC 1 cut(s) 245
CviAII CATG 1 cut(s) 80
CviJI RGCY 7 cut(s) 32, 40, 50, 66, 78, 251, 273
CviKI_1 RGCY 7 cut(s) 32, 40, 50, 66, 78, 251, 273
CviQI GTAC 1 cut(s) 245
DdeI CTNAG 1 cut(s) 33
EcoNI CCTNNNNNAGG 1 cut(s) 112
FaeI CATG 1 cut(s) 83
FatI CATG 1 cut(s) 79
FauNDI CATATG 1 cut(s) 235
FokI GGATG 1 cut(s) 165
FspBI CTAG 1 cut(s) 5
Hin1I GRCGYC 1 cut(s) 186
Hin1II CATG 1 cut(s) 83
Hpy166II GTNNAC 1 cut(s) 17
Hpy188I TCNGA 2 cut(s) 262, 284
Hpy188III TCNNGA 2 cut(s) 170, 182
Hpy8I GTNNAC 1 cut(s) 17
HpyAV CCTTC 1 cut(s) 56
HpyCH4IV ACGT 1 cut(s) 186
HpyCH4V TGCA 2 cut(s) 223, 233
HpyF3I CTNAG 1 cut(s) 33
HpySE526I ACGT 1 cut(s) 186
Hsp92I GRCGYC 1 cut(s) 186
Hsp92II CATG 1 cut(s) 83
LmnI GCTCC 2 cut(s) 37, 117
LpnPI CCDG 6 cut(s) 36, 183, 195, 209, 233, 233
MaeI CTAG 1 cut(s) 5
MaeII ACGT 1 cut(s) 186
MboII GAAGA 1 cut(s) 172
MluCI AATT 1 cut(s) 292
MnlI CCTC 3 cut(s) 28, 155, 215
NdeI CATATG 1 cut(s) 235
NlaIII CATG 1 cut(s) 83
PstI CTGCAG 1 cut(s) 225
RsaI GTAC 1 cut(s) 246
RsaNI GTAC 1 cut(s) 245
SbfI CCTGCAGG 1 cut(s) 225
SdaI CCTGCAGG 1 cut(s) 225
SetI ASST 7 cut(s) 34, 42, 52, 88, 189, 197, 228
SfcI CTRYAG 1 cut(s) 221
SmlI CTYRAG 1 cut(s) 149
SmoI CTYRAG 1 cut(s) 149
Sse8387I CCTGCAGG 1 cut(s) 225
Sse9I AATT 1 cut(s) 292
SspMI CTAG 1 cut(s) 5
TaiI ACGT 1 cut(s) 189
TasI AATT 1 cut(s) 292
TatI WGTACW 1 cut(s) 244
TspDTI ATGAA 2 cut(s) 96, 173
XagI CCTNNNNNAGG 1 cut(s) 112
XapI RAATTY 1 cut(s) 292
XspI CTAG 1 cut(s) 5
ZraI GACGTC 1 cut(s) 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.