Rh5AG195600

Pentatricopeptide repeat-containing protein At5g48730

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
22715259 .. 22717679
2421 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG195600.1

Sequence Viewer

Length: 165 bp
ATGATTGACGAAGGCTGTGGTGTCAGCCATGAACCTTATACTGCTCTTATATCTGCCTATGGCAAACCAGTCTTAAATAGAACCATGAGTACATGCATCTTCATCAATCCAAACATTCCCGACAGAGCGGAGTACAAACAAAGGAATCAGCACCTGTCTACCTAA

Protein Analysis

54

Amino Acids

6.08

Weight (kDa)

6.7

Isoelectric Point (pI)

28.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 128
AccI GTMKAC 1 cut(s) 158
AciI CCGC 1 cut(s) 128
AfaI GTAC 2 cut(s) 91, 134
AlwNI CAGNNNCTG 1 cut(s) 154
BmsI GCATC 1 cut(s) 105
Bse1I ACTGG 1 cut(s) 68
BseNI ACTGG 1 cut(s) 68
BspACI CCGC 1 cut(s) 128
BsrBI CCGCTC 1 cut(s) 128
BsrI ACTGG 1 cut(s) 68
BstNSI RCATGY 1 cut(s) 96
CaiI CAGNNNCTG 1 cut(s) 154
Csp6I GTAC 2 cut(s) 90, 133
CviAII CATG 3 cut(s) 29, 85, 93
CviJI RGCY 2 cut(s) 15, 27
CviKI_1 RGCY 2 cut(s) 15, 27
CviQI GTAC 2 cut(s) 90, 133
EcoT22I ATGCAT 1 cut(s) 98
FaeI CATG 3 cut(s) 32, 88, 96
FaiI YATR 6 cut(s) 30, 39, 50, 60, 86, 94
FatI CATG 3 cut(s) 28, 84, 92
FblI GTMKAC 1 cut(s) 158
Hin1II CATG 3 cut(s) 32, 88, 96
HinfI GANTC 1 cut(s) 145
Hpy166II GTNNAC 1 cut(s) 159
Hpy188III TCNNGA 1 cut(s) 119
Hpy8I GTNNAC 1 cut(s) 159
HpyAV CCTTC 1 cut(s) 5
HpyCH4V TGCA 1 cut(s) 96
Hsp92II CATG 3 cut(s) 32, 88, 96
LpnPI CCDG 1 cut(s) 81
LweI GCATC 1 cut(s) 105
MbiI CCGCTC 1 cut(s) 128
MboII GAAGA 1 cut(s) 91
Mph1103I ATGCAT 1 cut(s) 98
MseI TTAA 1 cut(s) 74
NlaIII CATG 3 cut(s) 32, 88, 96
NsiI ATGCAT 1 cut(s) 98
NspI RCATGY 1 cut(s) 96
PfeI GAWTC 1 cut(s) 145
PsrI GAACNNNNNNTAC 2 cut(s) 73, 105
PstNI CAGNNNCTG 1 cut(s) 154
RsaI GTAC 2 cut(s) 91, 134
RsaNI GTAC 2 cut(s) 90, 133
SaqAI TTAA 1 cut(s) 74
SetI ASST 3 cut(s) 37, 156, 164
SfaNI GCATC 1 cut(s) 105
SgeI CNNG 5 cut(s) 41, 80, 97, 105, 131
SsiI CCGC 1 cut(s) 128
TatI WGTACW 2 cut(s) 89, 132
TfiI GAWTC 1 cut(s) 145
Tru1I TTAA 1 cut(s) 74
Tru9I TTAA 1 cut(s) 74
TspDTI ATGAA 2 cut(s) 45, 91
XceI RCATGY 1 cut(s) 96
XmiI GTMKAC 1 cut(s) 158
Zsp2I ATGCAT 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.