Rmu_sc0005399.1_g000019

Pentatricopeptide repeat-containing protein At5g48730

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005399.1
Physical Location & Seq
Forward (+)
91111 .. 91518
408 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005399.1_g000019.1.cds

Sequence Viewer

Length: 408 bp
atgctaggaaaatgtaaacaaccagaaaaagctgaggagctttttcaagctatgattgacgaaggctgtggtgtcagccatgaaccttatactgctcttatatctgcctatggtaggagcagtctctttgacaaagcattttccctccttgagcagatgaagaatactcctgattgccagcctgacttccatacctattctatcctcataaaatcttgcctgcaggtttttgcatatgacaaagtacaggctctgctttcagatatggaaattcagcacattagacccaacaccatcacatacaataccctgatagatgcttacggaaatctaaaaagtattgcccacttatccttcctatccaaaattttgaatgctattttagttgctgtgaataatctactgtaa

Protein Analysis

135

Amino Acids

15.13

Weight (kDa)

5.73

Isoelectric Point (pI)

32.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 214
AcsI RAATTY 2 cut(s) 270, 366
AfaI GTAC 1 cut(s) 246
AfiI CCNNNNNNNGG 1 cut(s) 114
AgsI TTSAA 2 cut(s) 47, 373
AluBI AGCT 3 cut(s) 32, 40, 50
AluI AGCT 3 cut(s) 32, 40, 50
Alw26I GTCTC 1 cut(s) 128
AlwNI CAGNNNCTG 1 cut(s) 253
ApoI RAATTY 2 cut(s) 270, 366
BbvCI CCTCAGC 1 cut(s) 33
BccI CCATC 1 cut(s) 302
BcoDI GTCTC 1 cut(s) 128
BfaI CTAG 1 cut(s) 5
BfmI CTRYAG 1 cut(s) 221
BfuAI ACCTGC 1 cut(s) 214
BmsI GCATC 1 cut(s) 307
Bpu10I CCTNAGC 1 cut(s) 33
BpuEI CTTGAG 1 cut(s) 170
Bsc4I CCNNNNNNNGG 1 cut(s) 114
BseLI CCNNNNNNNGG 1 cut(s) 114
BseMII CTCAG 1 cut(s) 24
BseRI GAGGAG 1 cut(s) 50
BslI CCNNNNNNNGG 1 cut(s) 114
BsmAI GTCTC 1 cut(s) 128
BsmI GAATGC 1 cut(s) 379
BspCNI CTCAG 1 cut(s) 25
BspMAI CTGCAG 1 cut(s) 225
BspMI ACCTGC 1 cut(s) 214
Bst4CI ACNGT 1 cut(s) 405
BstC8I GCNNGC 2 cut(s) 179, 221
BstDEI CTNAG 1 cut(s) 33
BstENI CCTNNNNNAGG 1 cut(s) 112
BstMAI GTCTC 1 cut(s) 128
BstSFI CTRYAG 1 cut(s) 221
BveI ACCTGC 1 cut(s) 214
Cac8I GCNNGC 2 cut(s) 179, 221
CaiI CAGNNNCTG 1 cut(s) 253
Csp6I GTAC 1 cut(s) 245
CviAII CATG 1 cut(s) 80
CviJI RGCY 7 cut(s) 32, 40, 50, 66, 78, 181, 251
CviKI_1 RGCY 7 cut(s) 32, 40, 50, 66, 78, 181, 251
CviQI GTAC 1 cut(s) 245
DdeI CTNAG 1 cut(s) 33
EcoNI CCTNNNNNAGG 1 cut(s) 112
FaeI CATG 1 cut(s) 83
FatI CATG 1 cut(s) 79
FauNDI CATATG 1 cut(s) 235
FspBI CTAG 1 cut(s) 5
Hin1II CATG 1 cut(s) 83
Hpy166II GTNNAC 1 cut(s) 17
Hpy188I TCNGA 1 cut(s) 262
Hpy188III TCNNGA 1 cut(s) 170
Hpy8I GTNNAC 1 cut(s) 17
HpyAV CCTTC 2 cut(s) 56, 364
HpyCH4III ACNGT 1 cut(s) 405
HpyCH4V TGCA 2 cut(s) 223, 233
HpyF3I CTNAG 1 cut(s) 33
Hsp92II CATG 1 cut(s) 83
LmnI GCTCC 2 cut(s) 37, 117
LpnPI CCDG 8 cut(s) 36, 183, 191, 195, 209, 233, 233, 323
LweI GCATC 1 cut(s) 307
MaeI CTAG 1 cut(s) 5
MboII GAAGA 1 cut(s) 172
MluCI AATT 2 cut(s) 270, 366
MnlI CCTC 3 cut(s) 28, 155, 215
Mva1269I GAATGC 1 cut(s) 379
NdeI CATATG 1 cut(s) 235
NlaIII CATG 1 cut(s) 83
PctI GAATGC 1 cut(s) 379
PstI CTGCAG 1 cut(s) 225
PstNI CAGNNNCTG 1 cut(s) 253
RsaI GTAC 1 cut(s) 246
RsaNI GTAC 1 cut(s) 245
SbfI CCTGCAGG 1 cut(s) 225
SdaI CCTGCAGG 1 cut(s) 225
SetI ASST 6 cut(s) 34, 42, 52, 88, 197, 228
SfaNI GCATC 1 cut(s) 307
SfcI CTRYAG 1 cut(s) 221
SmlI CTYRAG 1 cut(s) 149
SmoI CTYRAG 1 cut(s) 149
Sse8387I CCTGCAGG 1 cut(s) 225
Sse9I AATT 2 cut(s) 270, 366
SspMI CTAG 1 cut(s) 5
TaaI ACNGT 1 cut(s) 405
TasI AATT 2 cut(s) 270, 366
TatI WGTACW 1 cut(s) 244
TspDTI ATGAA 2 cut(s) 96, 173
TspGWI ACGGA 1 cut(s) 339
XagI CCTNNNNNAGG 1 cut(s) 112
XapI RAATTY 2 cut(s) 270, 366
XspI CTAG 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.