RchiOBHm_Chr2g0153721

OTU domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
71012713 .. 71013663
951 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ52279

Sequence Viewer

Length: 291 bp
ATGACTTTATGGTTATTTTGTACAGGCATACGCGGAGATGGAAGGTGTTTGTTTCGATTTGTGGTTCATGGAGCTTGTCTAAGAGCAGGGAAGCCATCTCCAAGTGAAAGCCATCAGAAAGAACTTGCAGATGAGCTTAGAGAGAAGGTAGCAGATGAATTCATTAAGAGGAGGGCTGATATTGAATGGTTTCTTGAAGATGATTTTGAGAGATACATTGTACAGCTGTGGCAACCCCACATTTGGGGAGGCGAGCCTGAGTTGCTTATGTCCTCACATGTCCTACAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

96

Amino Acids

11.27

Weight (kDa)

5.5

Isoelectric Point (pI)

65.43

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
OTU PF02338 11 - 96 3.4e-17 OTU-like cysteine protease
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 33
AciI CCGC 1 cut(s) 33
AcsI RAATTY 1 cut(s) 158
AfaI GTAC 2 cut(s) 22, 222
AfiI CCNNNNNNNGG 2 cut(s) 243, 244
AflIII ACRYGT 1 cut(s) 277
AgsI TTSAA 2 cut(s) 185, 197
AluBI AGCT 3 cut(s) 74, 136, 226
AluI AGCT 3 cut(s) 74, 136, 226
ApoI RAATTY 1 cut(s) 158
Asp700I GAANNNNTTC 1 cut(s) 189
BccI CCATC 3 cut(s) 32, 103, 120
BfmI CTRYAG 1 cut(s) 284
Bsc4I CCNNNNNNNGG 2 cut(s) 243, 244
BseLI CCNNNNNNNGG 2 cut(s) 243, 244
BseMII CTCAG 1 cut(s) 249
BseRI GAGGAG 1 cut(s) 184
Bsh1236I CGCG 1 cut(s) 33
BslI CCNNNNNNNGG 2 cut(s) 243, 244
Bsp1407I TGTACA 2 cut(s) 20, 220
BspACI CCGC 1 cut(s) 33
BspCNI CTCAG 1 cut(s) 250
BspFNI CGCG 1 cut(s) 33
BsrGI TGTACA 2 cut(s) 20, 220
Bst4CI ACNGT 1 cut(s) 288
BstAUI TGTACA 2 cut(s) 20, 220
BstC8I GCNNGC 1 cut(s) 254
BstDEI CTNAG 3 cut(s) 80, 137, 258
BstFNI CGCG 1 cut(s) 33
BstMWI GCNNNNNNNGC 1 cut(s) 262
BstNSI RCATGY 1 cut(s) 281
BstSFI CTRYAG 1 cut(s) 284
BstUI CGCG 1 cut(s) 33
Cac8I GCNNGC 1 cut(s) 254
Csp6I GTAC 2 cut(s) 21, 221
CviAII CATG 2 cut(s) 68, 278
CviJI RGCY 7 cut(s) 74, 94, 111, 136, 176, 226, 256
CviKI_1 RGCY 7 cut(s) 74, 94, 111, 136, 176, 226, 256
CviQI GTAC 2 cut(s) 21, 221
DdeI CTNAG 3 cut(s) 80, 137, 258
EcoRI GAATTC 1 cut(s) 158
FaeI CATG 2 cut(s) 71, 281
FaiI YATR 5 cut(s) 10, 29, 69, 269, 279
FatI CATG 2 cut(s) 67, 277
Hin1II CATG 2 cut(s) 71, 281
Hpy188I TCNGA 1 cut(s) 117
Hpy188III TCNNGA 1 cut(s) 194
HpyAV CCTTC 2 cut(s) 36, 139
HpyCH4III ACNGT 1 cut(s) 288
HpyCH4V TGCA 1 cut(s) 128
HpyF10VI GCNNNNNNNGC 1 cut(s) 262
HpyF3I CTNAG 3 cut(s) 80, 137, 258
Hsp92II CATG 2 cut(s) 71, 281
LmnI GCTCC 1 cut(s) 71
LpnPI CCDG 3 cut(s) 9, 72, 270
MboII GAAGA 1 cut(s) 209
MluCI AATT 1 cut(s) 158
MnlI CCTC 4 cut(s) 162, 165, 242, 283
MroXI GAANNNNTTC 1 cut(s) 189
MseI TTAA 1 cut(s) 165
MspA1I CMGCKG 1 cut(s) 226
MvnI CGCG 1 cut(s) 33
MwoI GCNNNNNNNGC 1 cut(s) 262
NlaIII CATG 2 cut(s) 71, 281
NspI RCATGY 1 cut(s) 281
PciI ACATGT 1 cut(s) 277
PdmI GAANNNNTTC 1 cut(s) 189
PscI ACATGT 1 cut(s) 277
PvuII CAGCTG 1 cut(s) 226
RsaI GTAC 2 cut(s) 22, 222
RsaNI GTAC 2 cut(s) 21, 221
SaqAI TTAA 1 cut(s) 165
SetI ASST 5 cut(s) 47, 76, 138, 150, 228
SfcI CTRYAG 1 cut(s) 284
Sse9I AATT 1 cut(s) 158
SsiI CCGC 1 cut(s) 33
TaaI ACNGT 1 cut(s) 288
TaqI TCGA 1 cut(s) 55
TasI AATT 1 cut(s) 158
TatI WGTACW 2 cut(s) 20, 220
Tru1I TTAA 1 cut(s) 165
Tru9I TTAA 1 cut(s) 165
TspDTI ATGAA 3 cut(s) 56, 151, 171
XapI RAATTY 1 cut(s) 158
XceI RCATGY 1 cut(s) 281
XmnI GAANNNNTTC 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.