RchiOBHm_Chr2g0172961

Glutathione synthetase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
86139419 .. 86139676
258 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ54022

Sequence Viewer

Length: 258 bp
ATGGAGCAATCATCCGCCATCAAGTGTCCATCAATATCTTATCATCTAGTTGGAACAAAAAAAATTCAACAAGAACTTGCTAAGCCTAATGTTCTCGAGAGGTTCCTTGATGATAAAGAAGACATTGCAAGATTGCGGAAATGCTTTGCAAGATTGTGGAGTTTGGACGACTCAGAAATTGTTAGAAAAAGCAATGGAAAAGCCAGAGTTATTTGTCATGAAGCCCCAAAGAGAAGGCGGAGGGAACAATATCTATGA

Protein Analysis

85

Amino Acids

10.0

Weight (kDa)

9.67

Isoelectric Point (pI)

66.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GSH_synth_ATP PF03917 18 - 67 2.6e-15 Eukaryotic glutathione synthase, ATP binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 15, 136, 238
AcsI RAATTY 1 cut(s) 63
AgsI TTSAA 1 cut(s) 68
Ama87I CYCGRG 1 cut(s) 95
ApoI RAATTY 1 cut(s) 63
AvaI CYCGRG 1 cut(s) 95
BbsI GAAGAC 1 cut(s) 126
BccI CCATC 2 cut(s) 26, 37
BfaI CTAG 1 cut(s) 47
BlpI GCTNAGC 1 cut(s) 81
BmeT110I CYCGRG 1 cut(s) 95
BmiI GGNNCC 1 cut(s) 104
BpiI GAAGAC 1 cut(s) 126
Bpu1102I GCTNAGC 1 cut(s) 81
Bse3DI GCAATG 2 cut(s) 123, 199
BseGI GGATG 1 cut(s) 11
BseMI GCAATG 2 cut(s) 123, 199
BseMII CTCAG 1 cut(s) 186
BsiHKCI CYCGRG 1 cut(s) 95
BsoBI CYCGRG 1 cut(s) 95
Bsp1720I GCTNAGC 1 cut(s) 81
BspACI CCGC 3 cut(s) 15, 136, 238
BspCNI CTCAG 1 cut(s) 185
BspHI TCATGA 1 cut(s) 217
BspLI GGNNCC 1 cut(s) 104
BsrDI GCAATG 2 cut(s) 123, 199
BstDEI CTNAG 2 cut(s) 81, 172
BstF5I GGATG 1 cut(s) 11
BstV2I GAAGAC 1 cut(s) 126
BtsCI GGATG 1 cut(s) 11
CciI TCATGA 1 cut(s) 217
CviAII CATG 1 cut(s) 218
CviJI RGCY 3 cut(s) 85, 203, 224
CviKI_1 RGCY 3 cut(s) 85, 203, 224
DdeI CTNAG 2 cut(s) 81, 172
EciI GGCGGA 2 cut(s) 4, 253
Eco88I CYCGRG 1 cut(s) 95
FaeI CATG 1 cut(s) 221
FaiI YATR 2 cut(s) 219, 256
FatI CATG 1 cut(s) 217
FspBI CTAG 1 cut(s) 47
Hin1II CATG 1 cut(s) 221
HinfI GANTC 1 cut(s) 170
Hpy188I TCNGA 1 cut(s) 175
Hpy188III TCNNGA 3 cut(s) 95, 97, 218
HpyAV CCTTC 1 cut(s) 228
HpyCH4V TGCA 2 cut(s) 128, 149
HpyF3I CTNAG 2 cut(s) 81, 172
Hsp92II CATG 1 cut(s) 221
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 1 cut(s) 217
MaeI CTAG 1 cut(s) 47
MboII GAAGA 1 cut(s) 131
MluCI AATT 2 cut(s) 63, 177
MlyI GAGTC 1 cut(s) 164
MmeI TCCRAC 1 cut(s) 31
MnlI CCTC 2 cut(s) 93, 234
NlaIII CATG 1 cut(s) 221
NlaIV GGNNCC 1 cut(s) 104
PaeR7I CTCGAG 1 cut(s) 95
PagI TCATGA 1 cut(s) 217
PleI GAGTC 1 cut(s) 164
PpsI GAGTC 1 cut(s) 164
PspN4I GGNNCC 1 cut(s) 104
SchI GAGTC 1 cut(s) 164
SetI ASST 1 cut(s) 104
Sfr274I CTCGAG 1 cut(s) 95
SlaI CTCGAG 1 cut(s) 95
SmlI CTYRAG 1 cut(s) 95
SmoI CTYRAG 1 cut(s) 95
Sse9I AATT 2 cut(s) 63, 177
SsiI CCGC 3 cut(s) 15, 136, 238
SspMI CTAG 1 cut(s) 47
TaqI TCGA 1 cut(s) 96
TasI AATT 2 cut(s) 63, 177
TspDTI ATGAA 1 cut(s) 234
XapI RAATTY 1 cut(s) 63
XhoI CTCGAG 1 cut(s) 95
XspI CTAG 1 cut(s) 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.