RchiOBHm_Chr6g0303351

Glutathione synthetase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
63099586 .. 63101393
1808 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ27252

Sequence Viewer

Length: 150 bp
ATGATACACGCCCCGTTCGCTTTACTTCTGATGCCCTTTCCAGAAACTCAGTTGAATCAAGCAAATGAGTTAGCCCCCATATTCAATGAACTTGTTGATAGAGTGAGTTTGGATGCAAAATTCTTGCAGGATTCATTGTCCAGAAATTGA

Protein Analysis

49

Amino Acids

5.57

Weight (kDa)

4.58

Isoelectric Point (pI)

57.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GSH_synth_ATP PF03917 2 - 47 7.2e-10 Eukaryotic glutathione synthase, ATP binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 119
AgsI TTSAA 2 cut(s) 55, 85
ApoI RAATTY 1 cut(s) 119
BmsI GCATC 2 cut(s) 21, 103
BseGI GGATG 1 cut(s) 118
BseMII CTCAG 1 cut(s) 62
BspCNI CTCAG 1 cut(s) 61
BstDEI CTNAG 1 cut(s) 48
BstF5I GGATG 1 cut(s) 118
BstMWI GCNNNNNNNGC 1 cut(s) 17
BtsCI GGATG 1 cut(s) 118
CviJI RGCY 1 cut(s) 74
CviKI_1 RGCY 1 cut(s) 74
DdeI CTNAG 1 cut(s) 48
FaiI YATR 1 cut(s) 80
FokI GGATG 1 cut(s) 125
HinfI GANTC 2 cut(s) 55, 131
Hpy188I TCNGA 1 cut(s) 30
Hpy188III TCNNGA 2 cut(s) 41, 141
HpyCH4V TGCA 2 cut(s) 116, 127
HpyF10VI GCNNNNNNNGC 1 cut(s) 17
HpyF3I CTNAG 1 cut(s) 48
LpnPI CCDG 2 cut(s) 54, 113
LweI GCATC 2 cut(s) 21, 103
MluCI AATT 2 cut(s) 119, 145
MwoI GCNNNNNNNGC 1 cut(s) 17
PfeI GAWTC 2 cut(s) 55, 131
SfaNI GCATC 2 cut(s) 21, 103
SgeI CNNG 7 cut(s) 20, 25, 53, 71, 104, 136, 140
Sse9I AATT 2 cut(s) 119, 145
TasI AATT 2 cut(s) 119, 145
TfiI GAWTC 2 cut(s) 55, 131
TspDTI ATGAA 2 cut(s) 102, 123
XapI RAATTY 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.