Rh2BG654300

Glutathione synthetase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
87085660 .. 87086013
354 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG654300.1

Sequence Viewer

Length: 354 bp
ATGTCGTTTCCAGAAAGTCAGTTGAATAAAGCAAATGAGTTGGCTCCCATATTTAATGAACTTGTTGATCGAGTGAGTTTGGATATGAGATTCCTGCAGGATTCACAGTCCAGAATGAAGAAAGCAGATCCTTTTACATCTATACTTCTAGATATTCATGCCAAGATGCTAGAGAATAACAAGAAAGAGGAGATACGCTTGGGTTTGCATCGCTCAAATTGTATGCTTGATGAACAGTCTAAATTACTCCTTCAGATAGAGATGAACACAATTTCGTCTTCATTTGCAGGGCTGGTCTTGTCTGCCAACTTCACAGGAGCTTACTTGGTAACTATGGAGAATTTCTTAGATTAG

Protein Analysis

117

Amino Acids

13.34

Weight (kDa)

5.14

Isoelectric Point (pI)

62.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GSH_synth_ATP PF03917 2 - 103 2.7e-28 Eukaryotic glutathione synthase, ATP binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 122
AcsI RAATTY 1 cut(s) 340
AcuI CTGAAG 1 cut(s) 236
AgsI TTSAA 1 cut(s) 25
AluBI AGCT 1 cut(s) 320
AluI AGCT 1 cut(s) 320
AlwI GGATC 1 cut(s) 122
ApoI RAATTY 1 cut(s) 340
BbsI GAAGAC 1 cut(s) 270
BfaI CTAG 2 cut(s) 149, 170
BfmI CTRYAG 1 cut(s) 95
BmiI GGNNCC 1 cut(s) 45
BmsI GCATC 2 cut(s) 156, 217
BpiI GAAGAC 1 cut(s) 270
BseRI GAGGAG 1 cut(s) 203
Bsp143I GATC 2 cut(s) 67, 127
BspLI GGNNCC 1 cut(s) 45
BspMAI CTGCAG 1 cut(s) 99
BspPI GGATC 1 cut(s) 122
BssMI GATC 2 cut(s) 67, 127
Bst4CI ACNGT 2 cut(s) 108, 237
BstDEI CTNAG 1 cut(s) 346
BstKTI GATC 2 cut(s) 70, 130
BstMBI GATC 2 cut(s) 67, 127
BstSFI CTRYAG 1 cut(s) 95
BstV2I GAAGAC 1 cut(s) 270
BstX2I RGATCY 1 cut(s) 127
BstYI RGATCY 1 cut(s) 127
BtgZI GCGATG 1 cut(s) 194
CviAII CATG 1 cut(s) 158
CviJI RGCY 3 cut(s) 44, 292, 320
CviKI_1 RGCY 3 cut(s) 44, 292, 320
DdeI CTNAG 1 cut(s) 346
DpnI GATC 2 cut(s) 69, 129
DpnII GATC 2 cut(s) 67, 127
Eco57I CTGAAG 1 cut(s) 236
FaeI CATG 1 cut(s) 161
FaiI YATR 6 cut(s) 50, 86, 143, 159, 224, 335
FatI CATG 1 cut(s) 157
FspBI CTAG 2 cut(s) 149, 170
Hin1II CATG 1 cut(s) 161
HinfI GANTC 2 cut(s) 90, 101
Hpy188I TCNGA 1 cut(s) 255
Hpy188III TCNNGA 3 cut(s) 11, 111, 149
HpyAV CCTTC 1 cut(s) 260
HpyCH4III ACNGT 2 cut(s) 108, 237
HpyCH4V TGCA 3 cut(s) 97, 208, 287
HpyF3I CTNAG 1 cut(s) 346
Hsp92II CATG 1 cut(s) 161
Kzo9I GATC 2 cut(s) 67, 127
LmnI GCTCC 2 cut(s) 49, 317
LpnPI CCDG 7 cut(s) 24, 83, 107, 124, 273, 278, 300
LweI GCATC 2 cut(s) 156, 217
MaeI CTAG 2 cut(s) 149, 170
MaeIII GTNAC 1 cut(s) 328
MalI GATC 2 cut(s) 69, 129
MboI GATC 2 cut(s) 67, 127
MboII GAAGA 2 cut(s) 130, 270
MflI RGATCY 1 cut(s) 127
MluCI AATT 4 cut(s) 217, 242, 270, 340
MnlI CCTC 1 cut(s) 181
MseI TTAA 1 cut(s) 54
NdeII GATC 2 cut(s) 67, 127
NlaIII CATG 1 cut(s) 161
NlaIV GGNNCC 1 cut(s) 45
PfeI GAWTC 2 cut(s) 90, 101
PspN4I GGNNCC 1 cut(s) 45
PstI CTGCAG 1 cut(s) 99
PsuI RGATCY 1 cut(s) 127
SaqAI TTAA 1 cut(s) 54
Sau3AI GATC 2 cut(s) 67, 127
SbfI CCTGCAGG 1 cut(s) 99
SdaI CCTGCAGG 1 cut(s) 99
SetI ASST 1 cut(s) 322
SfaNI GCATC 2 cut(s) 156, 217
SfcI CTRYAG 1 cut(s) 95
Sse8387I CCTGCAGG 1 cut(s) 99
Sse9I AATT 4 cut(s) 217, 242, 270, 340
SspMI CTAG 2 cut(s) 149, 170
TaaI ACNGT 2 cut(s) 108, 237
TaqI TCGA 1 cut(s) 70
TasI AATT 4 cut(s) 217, 242, 270, 340
TfiI GAWTC 2 cut(s) 90, 101
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TspDTI ATGAA 6 cut(s) 72, 131, 146, 246, 270, 278
XapI RAATTY 1 cut(s) 340
XbaI TCTAGA 1 cut(s) 148
XspI CTAG 2 cut(s) 149, 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.