RchiOBHm_Chr3g0447521

protein FAR1-RELATED SEQUENCE

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0001037
Physical Location & Seq
Reverse (-)
205895 .. 208527
2633 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ41498

Sequence Viewer

Length: 321 bp
ATGATTTCAATGAAGAAACTGAGTAATGGAAACTGGGTGGTTGCAAAGTTTGTCAAGGAGCACGCCCATTCCCTGACTCCTGGAAAGAGTGAAAACGGATTGAATGATGAATCTTCAGATGAACAGATAAAAATCAAAGAATTAACTCAACAGCTGATGGTTGAGCGAAAGAGGTCTGCTTCATATAGAAAAATCATAGACCTCCTATTTAATCACATTGACGACCACACTCAACACCTCTCACAAAAGATCCTGCGCGTTAATGACATTCTCAAAGACATCGCATCCTCTGAAGCAAAAGGCCGTCAAAATCTCCGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
FAR1

Protein Analysis

106

Amino Acids

12.19

Weight (kDa)

9.47

Isoelectric Point (pI)

26.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 258
AciI CCGC 1 cut(s) 316
AclWI GGATC 1 cut(s) 244
AcuI CTGAAG 2 cut(s) 99, 312
AgsI TTSAA 2 cut(s) 9, 103
AjnI CCWGG 1 cut(s) 79
AluBI AGCT 1 cut(s) 154
AluI AGCT 1 cut(s) 154
Alw21I GWGCWC 1 cut(s) 63
AlwI GGATC 1 cut(s) 244
AoxI GGCC 1 cut(s) 301
AspLEI GCGC 1 cut(s) 258
Bbv12I GWGCWC 1 cut(s) 63
BccI CCATC 1 cut(s) 151
BceAI ACGGC 1 cut(s) 288
BciT130I CCWGG 1 cut(s) 81
BfaI CTAG 1 cut(s) 319
Bme1390I CCNGG 1 cut(s) 81
BmrFI CCNGG 1 cut(s) 81
BmrI ACTGGG 1 cut(s) 43
BmsI GCATC 1 cut(s) 293
BmuI ACTGGG 1 cut(s) 43
BsaBI GATNNNNATC 1 cut(s) 131
Bse1I ACTGG 1 cut(s) 38
Bse8I GATNNNNATC 1 cut(s) 131
BseBI CCWGG 1 cut(s) 81
BseGI GGATG 1 cut(s) 284
BseJI GATNNNNATC 1 cut(s) 131
BseMII CTCAG 1 cut(s) 11
BseNI ACTGG 1 cut(s) 38
Bsh1236I CGCG 1 cut(s) 258
BshFI GGCC 1 cut(s) 303
BsiHKAI GWGCWC 1 cut(s) 63
BsnI GGCC 1 cut(s) 303
Bsp1286I GDGCHC 1 cut(s) 63
Bsp143I GATC 1 cut(s) 249
BspACI CCGC 1 cut(s) 316
BspANI GGCC 1 cut(s) 303
BspCNI CTCAG 1 cut(s) 12
BspFNI CGCG 1 cut(s) 258
BspPI GGATC 1 cut(s) 244
BsrI ACTGG 1 cut(s) 38
BssMI GATC 1 cut(s) 249
Bst2UI CCWGG 1 cut(s) 81
BstC8I GCNNGC 1 cut(s) 63
BstDEI CTNAG 1 cut(s) 20
BstF5I GGATG 1 cut(s) 284
BstFNI CGCG 1 cut(s) 258
BstHHI GCGC 1 cut(s) 258
BstKTI GATC 1 cut(s) 252
BstMBI GATC 1 cut(s) 249
BstNI CCWGG 1 cut(s) 81
BstSCI CCNGG 1 cut(s) 79
BstUI CGCG 1 cut(s) 258
BstX2I RGATCY 1 cut(s) 249
BstYI RGATCY 1 cut(s) 249
BsuRI GGCC 1 cut(s) 303
BtgZI GCGATG 1 cut(s) 265
BtsCI GGATG 1 cut(s) 284
Cac8I GCNNGC 1 cut(s) 63
CfoI GCGC 1 cut(s) 258
CviJI RGCY 2 cut(s) 154, 303
CviKI_1 RGCY 2 cut(s) 154, 303
DdeI CTNAG 1 cut(s) 20
DpnI GATC 1 cut(s) 251
DpnII GATC 1 cut(s) 249
Eco57I CTGAAG 2 cut(s) 99, 312
EcoRII CCWGG 1 cut(s) 79
FaiI YATR 3 cut(s) 184, 186, 197
FokI GGATG 1 cut(s) 271
FspBI CTAG 1 cut(s) 319
GlaI GCGC 1 cut(s) 257
HaeIII GGCC 1 cut(s) 303
HhaI GCGC 1 cut(s) 258
Hin6I GCGC 1 cut(s) 256
HinP1I GCGC 1 cut(s) 256
HinfI GANTC 2 cut(s) 76, 110
Hpy188I TCNGA 2 cut(s) 118, 292
HpyCH4V TGCA 1 cut(s) 44
HpyF3I CTNAG 1 cut(s) 20
HspAI GCGC 1 cut(s) 256
Kzo9I GATC 1 cut(s) 249
LmnI GCTCC 1 cut(s) 58
LpnPI CCDG 5 cut(s) 19, 66, 86, 93, 266
LweI GCATC 1 cut(s) 293
MaeI CTAG 1 cut(s) 319
MalI GATC 1 cut(s) 251
MboI GATC 1 cut(s) 249
MboII GAAGA 2 cut(s) 25, 105
MflI RGATCY 1 cut(s) 249
MhlI GDGCHC 1 cut(s) 63
MluCI AATT 1 cut(s) 140
MlyI GAGTC 1 cut(s) 70
MnlI CCTC 4 cut(s) 165, 212, 248, 298
MseI TTAA 3 cut(s) 143, 210, 261
MspA1I CMGCKG 1 cut(s) 154
MspR9I CCNGG 1 cut(s) 81
MvaI CCWGG 1 cut(s) 81
MvnI CGCG 1 cut(s) 258
NdeII GATC 1 cut(s) 249
PfeI GAWTC 1 cut(s) 110
PfoI TCCNGGA 1 cut(s) 79
PleI GAGTC 1 cut(s) 70
PpsI GAGTC 1 cut(s) 70
Psp6I CCWGG 1 cut(s) 79
PspGI CCWGG 1 cut(s) 79
PsuI RGATCY 1 cut(s) 249
PvuII CAGCTG 1 cut(s) 154
SaqAI TTAA 3 cut(s) 143, 210, 261
Sau3AI GATC 1 cut(s) 249
SchI GAGTC 1 cut(s) 70
ScrFI CCNGG 1 cut(s) 81
SduI GDGCHC 1 cut(s) 63
SetI ASST 4 cut(s) 156, 176, 204, 240
SfaNI GCATC 1 cut(s) 293
SgeI CNNG 8 cut(s) 46, 67, 74, 85, 92, 93, 265, 269
Sse9I AATT 1 cut(s) 140
SsiI CCGC 1 cut(s) 316
SspMI CTAG 1 cut(s) 319
StyD4I CCNGG 1 cut(s) 79
TasI AATT 1 cut(s) 140
TfiI GAWTC 1 cut(s) 110
Tru1I TTAA 3 cut(s) 143, 210, 261
Tru9I TTAA 3 cut(s) 143, 210, 261
TspDTI ATGAA 4 cut(s) 26, 123, 135, 171
TspGWI ACGGA 1 cut(s) 111
XspI CTAG 1 cut(s) 319
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.