RchiOBHm_Chr3g0449971

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
1611335 .. 1614243
2909 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ41732

Sequence Viewer

Length: 156 bp
ATGGATTCAATTTGGATAAACTTTGCACTCAAAGCATCAACTGATGACCAAAGCAATGTTCATTTCTGTTCTGTTTGTCTAGAAGAAGTGTTAGAGCCAAGATTGGGAAGCTACGGTTCAATGTTGTCAGCAAGCTCTTTATCATTTCCACTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.6

Weight (kDa)

4.29

Isoelectric Point (pI)

33.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 104
AgsI TTSAA 2 cut(s) 9, 120
AjuI GAANNNNNNNTTGG 2 cut(s) 42, 74
AluBI AGCT 2 cut(s) 111, 135
AluI AGCT 2 cut(s) 111, 135
BfaI CTAG 1 cut(s) 80
BmsI GCATC 1 cut(s) 44
Bsc4I CCNNNNNNNGG 1 cut(s) 104
Bse3DI GCAATG 1 cut(s) 61
BseLI CCNNNNNNNGG 1 cut(s) 104
BseMI GCAATG 1 cut(s) 61
BslI CCNNNNNNNGG 1 cut(s) 104
BsrDI GCAATG 1 cut(s) 61
Bst4CI ACNGT 1 cut(s) 116
BstC8I GCNNGC 1 cut(s) 133
BstMWI GCNNNNNNNGC 1 cut(s) 32
Cac8I GCNNGC 1 cut(s) 133
CviJI RGCY 3 cut(s) 97, 111, 135
CviKI_1 RGCY 3 cut(s) 97, 111, 135
FspBI CTAG 1 cut(s) 80
FspEI CC 5 cut(s) 62, 89, 90, 99, 111
HinfI GANTC 1 cut(s) 5
Hpy188III TCNNGA 1 cut(s) 80
HpyCH4III ACNGT 1 cut(s) 116
HpyCH4V TGCA 1 cut(s) 26
HpyF10VI GCNNNNNNNGC 1 cut(s) 32
LweI GCATC 1 cut(s) 44
MaeI CTAG 1 cut(s) 80
MboII GAAGA 1 cut(s) 95
MluCI AATT 1 cut(s) 9
MwoI GCNNNNNNNGC 1 cut(s) 32
PfeI GAWTC 1 cut(s) 5
SetI ASST 2 cut(s) 113, 137
SfaNI GCATC 1 cut(s) 44
SgeI CNNG 3 cut(s) 92, 111, 144
Sse9I AATT 1 cut(s) 9
SspMI CTAG 1 cut(s) 80
TaaI ACNGT 1 cut(s) 116
TasI AATT 1 cut(s) 9
TfiI GAWTC 1 cut(s) 5
TspDTI ATGAA 1 cut(s) 50
XbaI TCTAGA 1 cut(s) 79
XspI CTAG 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.