Rh5DG465600

Protein of unknown function (DUF632)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0002048
Physical Location & Seq
Reverse (-)
73994404 .. 73994723
320 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG465600.1

Sequence Viewer

Length: 222 bp
ATGTTAAGTAGGGACAAAGTTGGAGTTGAAGTAAAGGATTTGCATGCCAGAATTTTGTTTGCCATATGCAGTGGTGAATCAATACCACAAAGGATCGGAAAACTGAGAGATGAAGAGCTGCAGCCACAACTTATCAAGCTGCTAAAGGGCTTCATGAGAAATTGGTGGATAATCACCTGTTGGAACTGCATGAAACTCAAATCAAAATCATGTCTAGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF630 DUF632

Protein Analysis

73

Amino Acids

8.55

Weight (kDa)

9.3

Isoelectric Point (pI)

37.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF632 PF04782 5 - 57 5.8e-14 Protein of unknown function (DUF632)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 101
AcsI RAATTY 1 cut(s) 51
AgsI TTSAA 1 cut(s) 29
AluBI AGCT 2 cut(s) 118, 139
AluI AGCT 2 cut(s) 118, 139
AlwI GGATC 1 cut(s) 101
ApeKI GCWGC 3 cut(s) 118, 121, 139
ApoI RAATTY 1 cut(s) 51
AsuHPI GGTGA 2 cut(s) 86, 166
BbvI GCAGC 3 cut(s) 105, 126, 133
BfaI CTAG 1 cut(s) 215
BfmI CTRYAG 1 cut(s) 119
BisI GCNGC 3 cut(s) 119, 122, 140
BlsI GCNGC 3 cut(s) 120, 123, 141
BsaXI ACNNNNNCTCC 2 cut(s) 15, 45
BseMII CTCAG 1 cut(s) 95
BseXI GCAGC 3 cut(s) 105, 126, 133
BslFI GGGAC 1 cut(s) 26
BsmFI GGGAC 1 cut(s) 26
Bsp143I GATC 1 cut(s) 93
BspCNI CTCAG 1 cut(s) 96
BspHI TCATGA 1 cut(s) 153
BspMAI CTGCAG 1 cut(s) 123
BspPI GGATC 1 cut(s) 101
BspQI GCTCTTC 1 cut(s) 108
BssMI GATC 1 cut(s) 93
Bst6I CTCTTC 1 cut(s) 108
BstC8I GCNNGC 1 cut(s) 45
BstDEI CTNAG 1 cut(s) 104
BstKTI GATC 1 cut(s) 96
BstMBI GATC 1 cut(s) 93
BstNSI RCATGY 1 cut(s) 47
BstSFI CTRYAG 1 cut(s) 119
BstV1I GCAGC 3 cut(s) 105, 126, 133
BtsI GCAGTG 1 cut(s) 76
BtsIMutI CAGTG 1 cut(s) 76
Cac8I GCNNGC 1 cut(s) 45
CciI TCATGA 1 cut(s) 153
CviAII CATG 4 cut(s) 44, 154, 190, 210
CviJI RGCY 4 cut(s) 118, 124, 139, 150
CviKI_1 RGCY 4 cut(s) 118, 124, 139, 150
DdeI CTNAG 1 cut(s) 104
DpnI GATC 1 cut(s) 95
DpnII GATC 1 cut(s) 93
Eam1104I CTCTTC 1 cut(s) 108
EarI CTCTTC 1 cut(s) 108
FaeI CATG 4 cut(s) 47, 157, 193, 213
FaiI YATR 6 cut(s) 45, 65, 67, 155, 191, 211
FaqI GGGAC 1 cut(s) 26
FatI CATG 4 cut(s) 43, 153, 189, 209
FauNDI CATATG 1 cut(s) 65
Fnu4HI GCNGC 3 cut(s) 119, 122, 140
Fsp4HI GCNGC 3 cut(s) 119, 122, 140
FspBI CTAG 1 cut(s) 215
GluI GCNGC 3 cut(s) 119, 122, 140
Hin1II CATG 4 cut(s) 47, 157, 193, 213
HinfI GANTC 1 cut(s) 77
HphI GGTGA 2 cut(s) 86, 166
Hpy188I TCNGA 1 cut(s) 98
Hpy188III TCNNGA 2 cut(s) 154, 215
HpyCH4V TGCA 4 cut(s) 43, 69, 121, 189
HpyF3I CTNAG 1 cut(s) 104
Hsp92II CATG 4 cut(s) 47, 157, 193, 213
Kzo9I GATC 1 cut(s) 93
LguI GCTCTTC 1 cut(s) 108
LpnPI CCDG 2 cut(s) 61, 190
Lsp1109I GCAGC 3 cut(s) 105, 126, 133
MaeI CTAG 1 cut(s) 215
MalI GATC 1 cut(s) 95
MboI GATC 1 cut(s) 93
MboII GAAGA 1 cut(s) 125
MluCI AATT 2 cut(s) 51, 160
MmeI TCCRAC 1 cut(s) 161
MseI TTAA 1 cut(s) 5
NdeI CATATG 1 cut(s) 65
NdeII GATC 1 cut(s) 93
NlaIII CATG 4 cut(s) 47, 157, 193, 213
NspI RCATGY 1 cut(s) 47
PaeI GCATGC 1 cut(s) 47
PagI TCATGA 1 cut(s) 153
PciSI GCTCTTC 1 cut(s) 108
PfeI GAWTC 1 cut(s) 77
PkrI GCNGC 3 cut(s) 120, 123, 141
PstI CTGCAG 1 cut(s) 123
SapI GCTCTTC 1 cut(s) 108
SaqAI TTAA 1 cut(s) 5
SatI GCNGC 3 cut(s) 119, 122, 140
Sau3AI GATC 1 cut(s) 93
SetI ASST 3 cut(s) 120, 141, 179
SfcI CTRYAG 1 cut(s) 119
SgeI CNNG 6 cut(s) 56, 60, 148, 166, 189, 202
SphI GCATGC 1 cut(s) 47
Sse9I AATT 2 cut(s) 51, 160
SspMI CTAG 1 cut(s) 215
TasI AATT 2 cut(s) 51, 160
TfiI GAWTC 1 cut(s) 77
Tru1I TTAA 1 cut(s) 5
Tru9I TTAA 1 cut(s) 5
TscAI CASTG 1 cut(s) 76
TseI GCWGC 3 cut(s) 118, 121, 139
TspDTI ATGAA 3 cut(s) 126, 142, 206
TspRI CASTG 1 cut(s) 76
XapI RAATTY 1 cut(s) 51
XbaI TCTAGA 1 cut(s) 214
XceI RCATGY 1 cut(s) 47
XspI CTAG 1 cut(s) 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.