Rh7AG365200

Protein of unknown function (DUF632)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Forward (+)
47078995 .. 47080817
1823 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG365200.1

Sequence Viewer

Length: 156 bp
ATGAATGCTGAATCAATATCACAAAGGATCGGAAAACTGAGAGATGAAGAGCTGCAGCCACAACTTATCGAGCTGCTAAAGGGCTTCATGAGAAATTGGTGGATAATCACCTGTTGGAATTGCATGAAACTCAAAACAAAATCATGTCTACAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

51

Amino Acids

6.13

Weight (kDa)

9.02

Isoelectric Point (pI)

68.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF632 PF04782 3 - 35 4.5e-11 Protein of unknown function (DUF632)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 148
AclWI GGATC 1 cut(s) 35
AluBI AGCT 2 cut(s) 52, 73
AluI AGCT 2 cut(s) 52, 73
AlwI GGATC 1 cut(s) 35
ApeKI GCWGC 3 cut(s) 52, 55, 73
AsuHPI GGTGA 1 cut(s) 100
BbvI GCAGC 3 cut(s) 39, 60, 67
BfmI CTRYAG 2 cut(s) 53, 149
BisI GCNGC 3 cut(s) 53, 56, 74
BlsI GCNGC 3 cut(s) 54, 57, 75
BseMII CTCAG 1 cut(s) 29
BseXI GCAGC 3 cut(s) 39, 60, 67
BsmI GAATGC 1 cut(s) 10
Bsp143I GATC 1 cut(s) 27
BspCNI CTCAG 1 cut(s) 30
BspHI TCATGA 1 cut(s) 87
BspMAI CTGCAG 1 cut(s) 57
BspPI GGATC 1 cut(s) 35
BspQI GCTCTTC 1 cut(s) 42
BssMI GATC 1 cut(s) 27
Bst4CI ACNGT 1 cut(s) 153
Bst6I CTCTTC 1 cut(s) 42
BstDEI CTNAG 1 cut(s) 38
BstKTI GATC 1 cut(s) 30
BstMBI GATC 1 cut(s) 27
BstSFI CTRYAG 2 cut(s) 53, 149
BstV1I GCAGC 3 cut(s) 39, 60, 67
CciI TCATGA 1 cut(s) 87
CviAII CATG 3 cut(s) 88, 124, 144
CviJI RGCY 4 cut(s) 52, 58, 73, 84
CviKI_1 RGCY 4 cut(s) 52, 58, 73, 84
DdeI CTNAG 1 cut(s) 38
DpnI GATC 1 cut(s) 29
DpnII GATC 1 cut(s) 27
Eam1104I CTCTTC 1 cut(s) 42
EarI CTCTTC 1 cut(s) 42
FaeI CATG 3 cut(s) 91, 127, 147
FaiI YATR 3 cut(s) 89, 125, 145
FatI CATG 3 cut(s) 87, 123, 143
FblI GTMKAC 1 cut(s) 148
Fnu4HI GCNGC 3 cut(s) 53, 56, 74
Fsp4HI GCNGC 3 cut(s) 53, 56, 74
FspEI CC 9 cut(s) 10, 15, 65, 66, 72, 82, 85, 100, 124
GluI GCNGC 3 cut(s) 53, 56, 74
Hin1II CATG 3 cut(s) 91, 127, 147
HinfI GANTC 1 cut(s) 11
HphI GGTGA 1 cut(s) 100
Hpy166II GTNNAC 1 cut(s) 149
Hpy188I TCNGA 1 cut(s) 32
Hpy188III TCNNGA 1 cut(s) 88
Hpy8I GTNNAC 1 cut(s) 149
HpyCH4III ACNGT 1 cut(s) 153
HpyCH4V TGCA 2 cut(s) 55, 123
HpyF3I CTNAG 1 cut(s) 38
Hsp92II CATG 3 cut(s) 91, 127, 147
Kzo9I GATC 1 cut(s) 27
LguI GCTCTTC 1 cut(s) 42
LpnPI CCDG 1 cut(s) 124
Lsp1109I GCAGC 3 cut(s) 39, 60, 67
MalI GATC 1 cut(s) 29
MboI GATC 1 cut(s) 27
MboII GAAGA 1 cut(s) 59
MluCI AATT 2 cut(s) 94, 118
MmeI TCCRAC 1 cut(s) 95
Mva1269I GAATGC 1 cut(s) 10
NdeII GATC 1 cut(s) 27
NlaIII CATG 3 cut(s) 91, 127, 147
PagI TCATGA 1 cut(s) 87
PciSI GCTCTTC 1 cut(s) 42
PctI GAATGC 1 cut(s) 10
PfeI GAWTC 1 cut(s) 11
PkrI GCNGC 3 cut(s) 54, 57, 75
PstI CTGCAG 1 cut(s) 57
SapI GCTCTTC 1 cut(s) 42
SatI GCNGC 3 cut(s) 53, 56, 74
Sau3AI GATC 1 cut(s) 27
SetI ASST 3 cut(s) 54, 75, 113
SfcI CTRYAG 2 cut(s) 53, 149
SgeI CNNG 4 cut(s) 82, 100, 123, 136
Sse9I AATT 2 cut(s) 94, 118
TaaI ACNGT 1 cut(s) 153
TaqI TCGA 1 cut(s) 69
TasI AATT 2 cut(s) 94, 118
TfiI GAWTC 1 cut(s) 11
TseI GCWGC 3 cut(s) 52, 55, 73
TspDTI ATGAA 4 cut(s) 17, 60, 76, 140
XmiI GTMKAC 1 cut(s) 148
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.