Rmu_sc0021708.1_g000002

Protein of unknown function (DUF632)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0021708.1
Physical Location & Seq
Forward (+)
19027 .. 19710
684 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0021708.1_g000002.1.cds

Sequence Viewer

Length: 315 bp
atgcctatagtgagatcgctcgactgccccaccattggaatggtctgcaatgactcgcaccagcttgctactttcaagcttgaagccaaacttcaaaattggcatgcttgttttgcatcatacttttcttcccagaaagcgtacgttgctaatgctcttgcgacggcgcaaatgcagtggctaaaagtattggcgacgccaccaacgacgtcagaagcattgccgtcgcaaagccatcgccaatactcttttgcaaaggcaaatgaggctattgcgacggggatgcgccgtggctattgcaatttttttttgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

104

Amino Acids

11.59

Weight (kDa)

9.05

Isoelectric Point (pI)

46.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 212
AcyI GRCGYC 2 cut(s) 197, 209
AfaI GTAC 1 cut(s) 143
AfiI CCNNNNNNNGG 1 cut(s) 35
AgsI TTSAA 3 cut(s) 76, 83, 95
AluBI AGCT 2 cut(s) 64, 79
AluI AGCT 2 cut(s) 64, 79
AspLEI GCGC 2 cut(s) 169, 288
BccI CCATC 1 cut(s) 243
BceAI ACGGC 3 cut(s) 180, 208, 273
BcgI CGANNNNNNTGC 6 cut(s) 207, 218, 241, 252, 265, 299
BfmI CTRYAG 1 cut(s) 6
BmsI GCATC 2 cut(s) 125, 273
BsaHI GRCGYC 2 cut(s) 197, 209
BsaJI CCNNGG 1 cut(s) 289
Bsc4I CCNNNNNNNGG 1 cut(s) 35
Bse3DI GCAATG 2 cut(s) 55, 218
BseDI CCNNGG 1 cut(s) 289
BseGI GGATG 1 cut(s) 288
BseLI CCNNNNNNNGG 1 cut(s) 35
BseMI GCAATG 2 cut(s) 55, 218
BsiWI CGTACG 1 cut(s) 141
BslI CCNNNNNNNGG 1 cut(s) 35
Bsp143I GATC 1 cut(s) 14
BsrDI GCAATG 2 cut(s) 55, 218
BssECI CCNNGG 1 cut(s) 289
BssMI GATC 1 cut(s) 14
BssNI GRCGYC 2 cut(s) 197, 209
BstACI GRCGYC 2 cut(s) 197, 209
BstC8I GCNNGC 2 cut(s) 66, 105
BstDSI CCRYGG 1 cut(s) 289
BstF5I GGATG 1 cut(s) 288
BstHHI GCGC 2 cut(s) 169, 288
BstKTI GATC 1 cut(s) 17
BstMBI GATC 1 cut(s) 14
BstMWI GCNNNNNNNGC 3 cut(s) 113, 146, 266
BstNSI RCATGY 1 cut(s) 107
BstSFI CTRYAG 1 cut(s) 6
BstXI CCANNNNNNTGG 1 cut(s) 40
BtgI CCRYGG 1 cut(s) 289
BtgZI GCGATG 1 cut(s) 221
BtsCI GGATG 1 cut(s) 288
BtsI GCAGTG 1 cut(s) 182
BtsIMutI CAGTG 1 cut(s) 182
Cac8I GCNNGC 2 cut(s) 66, 105
CfoI GCGC 2 cut(s) 169, 288
CseI GACGC 1 cut(s) 205
Csp6I GTAC 1 cut(s) 142
CspCI CAANNNNNGTGG 2 cut(s) 158, 193
CviAII CATG 1 cut(s) 104
CviJI RGCY 7 cut(s) 64, 79, 86, 181, 234, 269, 294
CviKI_1 RGCY 7 cut(s) 64, 79, 86, 181, 234, 269, 294
CviQI GTAC 1 cut(s) 142
DpnI GATC 1 cut(s) 16
DpnII GATC 1 cut(s) 14
FaeI CATG 1 cut(s) 107
FaiI YATR 3 cut(s) 8, 105, 121
FalI AAGNNNNNCTT 2 cut(s) 75, 107
FatI CATG 1 cut(s) 103
FokI GGATG 1 cut(s) 295
GlaI GCGC 2 cut(s) 168, 287
HgaI GACGC 1 cut(s) 205
HhaI GCGC 2 cut(s) 169, 288
Hin1I GRCGYC 2 cut(s) 197, 209
Hin1II CATG 1 cut(s) 107
Hin6I GCGC 2 cut(s) 167, 286
HinP1I GCGC 2 cut(s) 167, 286
HindIII AAGCTT 1 cut(s) 77
HinfI GANTC 1 cut(s) 53
Hpy188I TCNGA 1 cut(s) 214
Hpy99I CGWCG 5 cut(s) 166, 199, 211, 229, 280
HpyCH4IV ACGT 2 cut(s) 144, 209
HpyCH4V TGCA 5 cut(s) 48, 116, 175, 254, 300
HpyF10VI GCNNNNNNNGC 3 cut(s) 113, 146, 266
HpySE526I ACGT 2 cut(s) 144, 209
Hsp92I GRCGYC 2 cut(s) 197, 209
Hsp92II CATG 1 cut(s) 107
HspAI GCGC 2 cut(s) 167, 286
Kzo9I GATC 1 cut(s) 14
LpnPI CCDG 2 cut(s) 74, 146
LweI GCATC 2 cut(s) 125, 273
MaeII ACGT 2 cut(s) 144, 209
MalI GATC 1 cut(s) 16
MboI GATC 1 cut(s) 14
MboII GAAGA 1 cut(s) 120
MluCI AATT 2 cut(s) 97, 301
MlyI GAGTC 1 cut(s) 47
MnlI CCTC 1 cut(s) 259
MslI CAYNNNNRTG 1 cut(s) 38
MwoI GCNNNNNNNGC 3 cut(s) 113, 146, 266
NdeII GATC 1 cut(s) 14
NlaIII CATG 1 cut(s) 107
NspI RCATGY 1 cut(s) 107
PaeI GCATGC 1 cut(s) 107
PcsI WCGNNNNNNNCGW 1 cut(s) 203
Pfl23II CGTACG 1 cut(s) 141
PleI GAGTC 1 cut(s) 47
PpsI GAGTC 1 cut(s) 47
PspLI CGTACG 1 cut(s) 141
RsaI GTAC 1 cut(s) 143
RsaNI GTAC 1 cut(s) 142
RseI CAYNNNNRTG 1 cut(s) 38
Sau3AI GATC 1 cut(s) 14
SchI GAGTC 1 cut(s) 47
SetI ASST 4 cut(s) 66, 81, 147, 212
SfaNI GCATC 2 cut(s) 125, 273
SfcI CTRYAG 1 cut(s) 6
SmiMI CAYNNNNRTG 1 cut(s) 38
SphI GCATGC 1 cut(s) 107
Sse9I AATT 2 cut(s) 97, 301
TaiI ACGT 2 cut(s) 147, 212
TaqI TCGA 1 cut(s) 21
TasI AATT 2 cut(s) 97, 301
TscAI CASTG 1 cut(s) 182
TspRI CASTG 1 cut(s) 182
XceI RCATGY 1 cut(s) 107
XcmI CCANNNNNNNNNTGG 1 cut(s) 37
ZraI GACGTC 1 cut(s) 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.