RchiOBHm_Chr4g0405631

Belongs to the eukaryotic ribosomal protein P1 P2 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
26278637 .. 26278795
159 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ37711

Sequence Viewer

Length: 159 bp
ATGAAGGTTGTTGCTGCGTATTTGCTCACTGTTCTGGACGGCAACACCAGCCCCTCTGTCGAGGACTTGAAAACCATTCTCGCCTCCGTTGGAACTGAAGTCGACAGCGACAGGATCAAGTTGGTATTGTCAGAACTCGAAGGGAAGAATGAAACGTAA

Protein Analysis

52

Amino Acids

5.56

Weight (kDa)

4.4

Isoelectric Point (pI)

21.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 102
AclWI GGATC 1 cut(s) 122
AcuI CTGAAG 1 cut(s) 117
AgsI TTSAA 1 cut(s) 70
AlwI GGATC 1 cut(s) 122
ApeKI GCWGC 1 cut(s) 14
BceAI ACGGC 1 cut(s) 55
BisI GCNGC 1 cut(s) 15
BlsI GCNGC 1 cut(s) 16
Bsp143I GATC 1 cut(s) 114
BspPI GGATC 1 cut(s) 122
BssMI GATC 1 cut(s) 114
Bst4CI ACNGT 1 cut(s) 31
BstKTI GATC 1 cut(s) 117
BstMBI GATC 1 cut(s) 114
BstMWI GCNNNNNNNGC 1 cut(s) 48
BtsIMutI CAGTG 1 cut(s) 27
CviJI RGCY 1 cut(s) 51
CviKI_1 RGCY 1 cut(s) 51
DpnI GATC 1 cut(s) 116
DpnII GATC 1 cut(s) 114
Eco57I CTGAAG 1 cut(s) 117
FblI GTMKAC 1 cut(s) 102
Fnu4HI GCNGC 1 cut(s) 15
Fsp4HI GCNGC 1 cut(s) 15
GluI GCNGC 1 cut(s) 15
HincII GTYRAC 1 cut(s) 103
HindII GTYRAC 1 cut(s) 103
Hpy166II GTNNAC 1 cut(s) 103
Hpy188I TCNGA 1 cut(s) 133
Hpy188III TCNNGA 1 cut(s) 35
Hpy8I GTNNAC 1 cut(s) 103
HpyAV CCTTC 1 cut(s) 134
HpyCH4III ACNGT 1 cut(s) 31
HpyCH4IV ACGT 1 cut(s) 155
HpyF10VI GCNNNNNNNGC 1 cut(s) 48
HpySE526I ACGT 1 cut(s) 155
Kzo9I GATC 1 cut(s) 114
LpnPI CCDG 3 cut(s) 20, 61, 97
MaeII ACGT 1 cut(s) 155
MalI GATC 1 cut(s) 116
MboI GATC 1 cut(s) 114
MboII GAAGA 1 cut(s) 157
MmeI TCCRAC 1 cut(s) 70
MnlI CCTC 3 cut(s) 55, 64, 94
MwoI GCNNNNNNNGC 1 cut(s) 48
NdeII GATC 1 cut(s) 114
PkrI GCNGC 1 cut(s) 16
SalI GTCGAC 1 cut(s) 101
SatI GCNGC 1 cut(s) 15
Sau3AI GATC 1 cut(s) 114
SetI ASST 2 cut(s) 9, 158
SgeI CNNG 8 cut(s) 47, 60, 73, 79, 92, 124, 130, 149
TaaI ACNGT 1 cut(s) 31
TaiI ACGT 1 cut(s) 158
TaqI TCGA 3 cut(s) 60, 102, 138
TscAI CASTG 1 cut(s) 34
TseI GCWGC 1 cut(s) 14
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 76
TspRI CASTG 1 cut(s) 34
XmiI GTMKAC 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.