Rw3G016340

Belongs to the eukaryotic ribosomal protein P1 P2 family

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr3
Physical Location & Seq
Forward (+)
17260115 .. 17261320
1206 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw3G016340.1

Sequence Viewer

Length: 306 bp
ATGAAGGTGATCGCTGCTTATTTGCTCGCTGTGTTGGGCGGCAAGACCAGCCCTACTGCCGAAGACATCAAGAGCATCCTTGGCGCTGTTGGTGCTGAAGCAGATGATGACAGGCTTCAGTTTCTTCTCAAGGAAGTTCAGGGTAAGGACATAACAGAGCTTATTGCCTCTGGAAGGGAGAAGTTGGCTTCTGTTCCATCTGGTGGTGGAGGTGCTGTTGCAGTGGCTGCCCCTGCTGGTGGCGGTGGTGCTGCTCAGATCTATATTTGTGCATTTTGTGATATGGGCTTCAGTCTGTTTGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

101

Amino Acids

10.12

Weight (kDa)

4.61

Isoelectric Point (pI)

30.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_60s PF00428 17 - 85 2.6e-13 60s Acidic ribosomal protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 203
AciI CCGC 2 cut(s) 39, 243
AcuI CTGAAG 3 cut(s) 101, 117, 274
AfiI CCNNNNNNNGG 3 cut(s) 174, 203, 239
AluBI AGCT 1 cut(s) 160
AluI AGCT 1 cut(s) 160
AlwNI CAGNNNCTG 1 cut(s) 227
ApeKI GCWGC 3 cut(s) 14, 227, 251
AspLEI GCGC 1 cut(s) 86
AsuHPI GGTGA 1 cut(s) 19
BbsI GAAGAC 1 cut(s) 69
BbvI GCAGC 2 cut(s) 214, 238
BccI CCATC 1 cut(s) 205
BfaI CTAG 1 cut(s) 304
BfoI RGCGCY 1 cut(s) 87
BglII AGATCT 1 cut(s) 258
BisI GCNGC 4 cut(s) 15, 40, 228, 252
BlsI GCNGC 4 cut(s) 16, 41, 229, 253
BmsI GCATC 1 cut(s) 84
BpiI GAAGAC 1 cut(s) 69
BpuEI CTTGAG 1 cut(s) 113
BsaJI CCNNGG 1 cut(s) 79
BsaXI ACNNNNNCTCC 2 cut(s) 201, 231
Bsc4I CCNNNNNNNGG 3 cut(s) 174, 203, 239
BseDI CCNNGG 1 cut(s) 79
BseGI GGATG 1 cut(s) 75
BseLI CCNNNNNNNGG 3 cut(s) 174, 203, 239
BseMII CTCAG 1 cut(s) 269
BseXI GCAGC 2 cut(s) 214, 238
BslI CCNNNNNNNGG 3 cut(s) 174, 203, 239
Bsp143I GATC 2 cut(s) 9, 258
BspACI CCGC 2 cut(s) 39, 243
BspCNI CTCAG 1 cut(s) 268
BssECI CCNNGG 1 cut(s) 79
BssMI GATC 2 cut(s) 9, 258
BssT1I CCWWGG 1 cut(s) 79
BstAPI GCANNNNNTGC 1 cut(s) 227
BstC8I GCNNGC 1 cut(s) 27
BstDEI CTNAG 1 cut(s) 255
BstENI CCTNNNNNAGG 1 cut(s) 172
BstF5I GGATG 1 cut(s) 75
BstH2I RGCGCY 1 cut(s) 87
BstHHI GCGC 1 cut(s) 86
BstKTI GATC 2 cut(s) 12, 261
BstMBI GATC 2 cut(s) 9, 258
BstMWI GCNNNNNNNGC 5 cut(s) 48, 81, 92, 227, 233
BstV1I GCAGC 2 cut(s) 214, 238
BstV2I GAAGAC 1 cut(s) 69
BstX2I RGATCY 1 cut(s) 258
BstYI RGATCY 1 cut(s) 258
BtsCI GGATG 1 cut(s) 75
BtsI GCAGTG 1 cut(s) 228
BtsIMutI CAGTG 1 cut(s) 228
Cac8I GCNNGC 1 cut(s) 27
CaiI CAGNNNCTG 1 cut(s) 227
CfoI GCGC 1 cut(s) 86
CviJI RGCY 6 cut(s) 51, 115, 160, 188, 227, 288
CviKI_1 RGCY 6 cut(s) 51, 115, 160, 188, 227, 288
DdeI CTNAG 1 cut(s) 255
DpnI GATC 2 cut(s) 11, 260
DpnII GATC 2 cut(s) 9, 258
Eco130I CCWWGG 1 cut(s) 79
Eco57I CTGAAG 3 cut(s) 101, 117, 274
EcoNI CCTNNNNNAGG 1 cut(s) 172
EcoT14I CCWWGG 1 cut(s) 79
ErhI CCWWGG 1 cut(s) 79
FaiI YATR 3 cut(s) 152, 264, 284
Fnu4HI GCNGC 4 cut(s) 15, 40, 228, 252
FokI GGATG 1 cut(s) 62
Fsp4HI GCNGC 4 cut(s) 15, 40, 228, 252
FspBI CTAG 1 cut(s) 304
GlaI GCGC 1 cut(s) 85
GluI GCNGC 4 cut(s) 15, 40, 228, 252
HaeII RGCGCY 1 cut(s) 87
HhaI GCGC 1 cut(s) 86
Hin6I GCGC 1 cut(s) 84
HinP1I GCGC 1 cut(s) 84
HphI GGTGA 1 cut(s) 19
Hpy188I TCNGA 1 cut(s) 258
Hpy188III TCNNGA 2 cut(s) 70, 171
HpyAV CCTTC 1 cut(s) 168
HpyCH4V TGCA 2 cut(s) 221, 272
HpyF10VI GCNNNNNNNGC 5 cut(s) 48, 81, 92, 227, 233
HpyF3I CTNAG 1 cut(s) 255
HspAI GCGC 1 cut(s) 84
Kzo9I GATC 2 cut(s) 9, 258
LpnPI CCDG 7 cut(s) 61, 97, 125, 156, 186, 222, 246
Lsp1109I GCAGC 2 cut(s) 214, 238
LweI GCATC 1 cut(s) 84
MaeI CTAG 1 cut(s) 304
MalI GATC 2 cut(s) 11, 260
MboI GATC 2 cut(s) 9, 258
MboII GAAGA 2 cut(s) 74, 116
MflI RGATCY 1 cut(s) 258
MnlI CCTC 2 cut(s) 178, 203
MwoI GCNNNNNNNGC 5 cut(s) 48, 81, 92, 227, 233
NdeII GATC 2 cut(s) 9, 258
PflMI CCANNNNNTGG 1 cut(s) 203
PkrI GCNGC 4 cut(s) 16, 41, 229, 253
PstNI CAGNNNCTG 1 cut(s) 227
PsuI RGATCY 1 cut(s) 258
SatI GCNGC 4 cut(s) 15, 40, 228, 252
Sau3AI GATC 2 cut(s) 9, 258
SetI ASST 3 cut(s) 9, 162, 214
SfaNI GCATC 1 cut(s) 84
SmlI CTYRAG 1 cut(s) 128
SmoI CTYRAG 1 cut(s) 128
SsiI CCGC 2 cut(s) 39, 243
SspMI CTAG 1 cut(s) 304
StyI CCWWGG 1 cut(s) 79
TauI GCSGC 1 cut(s) 42
TscAI CASTG 1 cut(s) 228
TseI GCWGC 3 cut(s) 14, 227, 251
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 228
Van91I CCANNNNNTGG 1 cut(s) 203
XagI CCTNNNNNAGG 1 cut(s) 172
XspI CTAG 1 cut(s) 304
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.