Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0001160

Physical Location & Seq

Genomic Coordinates Forward (+)

46535739 .. 46536372

Gene Structure 634 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ25402

Sequence Viewer

CDS Protein Promoter (2k)

Length: 138 bp

ATGCTATGCGTTTTGAGTTTTGGTGCTGAAGCAGATGATGACAGGCTTCAGTTTCTTCTCAAGGAAGTTCAGGGTAACGACATAACAGAGCTTATTGCCTCTGGAAGGGAGAAGTTGGCTTCTGTATTGAGATTATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

Ribosomal_60s

Protein Analysis

45

Amino Acids

4.98

Weight (kDa)

4.51

Isoelectric Point (pI)

11.12

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001160)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G27710 AT2G27710 AT2G27710 AT2G27710 AT2G27720 AT2G27720 AT2G27720 AT2G27720 AT3G44590 AT3G44590
fragaria_vesca	FvH4_6g18210 FvH4_6g25270
malus_domestica	MD03G1138800.v1.1 MD09G1183400.v1.1 MD09G1269400.v1.1 MD10G1207100.v1.1 MD11G1160300.v1.1 MD12G1022000.v1.1 MD14G1018800.v1.1
prunus_persica	Prupe.6G123800_v2.0.a1 Prupe.7G114700_v2.0.a1
pyrus_communis	pycom15g39030
rosa_chinensis	RchiOBHm_Chr3g0472541 RchiOBHm_Chr4g0405631 RchiOBHm_Chr5g0002791 RchiOBHm_Chr5g0043421 RchiOBHm_Chr6g0283321
rosa_laevigata	RLG00000002104 RLG00000024071 RLG00000031060 RLG00000034186
rosa_multiflora	Rmu_sc0001200.1_g000055 Rmu_sc0003510.1_g000027 Rmu_sc0011581.1_g000006 Rmu_sc0013603.1_g000017 Rmu_sc0041617.1_g000001 Rmu_ssc0000029.1_g000007 Rmu_ssc0000067.1_g000066 Rmu_ssc0000341.1_g000007
rosa_roxburghii	Rroxscaffold_1G00037460 Rroxscaffold_1G00073050 Rroxscaffold_6G00408850 Rroxscaffold_6G00416420
rosa_rugosa	Rorug03G0126400 Rorug03G0126500 Rorug04G0399600 Rorug05G0205800 Rorug05G0205900 Rorug05G0206500
rosa_samantha	Rh2BG054600 Rh5BG298200
rosa_wichuraiana	Rw1G008940 Rw1G014200 Rw2G048840 Rw3G016340 Rw5G002090 Rw5G027050

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcuI	CTGAAG	2 cut(s)	32, 48
AfiI	CCNNNNNNNGG	1 cut(s)	105
AluBI	AGCT	1 cut(s)	91
AluI	AGCT	1 cut(s)	91
BpuEI	CTTGAG	1 cut(s)	44
Bsc4I	CCNNNNNNNGG	1 cut(s)	105
BseLI	CCNNNNNNNGG	1 cut(s)	105
BslI	CCNNNNNNNGG	1 cut(s)	105
BstENI	CCTNNNNNAGG	1 cut(s)	103
CviJI	RGCY	3 cut(s)	46, 91, 119
CviKI_1	RGCY	3 cut(s)	46, 91, 119
Eco57I	CTGAAG	2 cut(s)	32, 48
EcoNI	CCTNNNNNAGG	1 cut(s)	103
FaiI	YATR	3 cut(s)	7, 83, 136
Hpy188III	TCNNGA	1 cut(s)	102
HpyAV	CCTTC	1 cut(s)	99
LpnPI	CCDG	3 cut(s)	28, 56, 87
MaeIII	GTNAC	1 cut(s)	74
MboII	GAAGA	1 cut(s)	47
MnlI	CCTC	1 cut(s)	109
SetI	ASST	1 cut(s)	93
SgeI	CNNG	4 cut(s)	55, 73, 83, 114
SmlI	CTYRAG	1 cut(s)	59
SmoI	CTYRAG	1 cut(s)	59
XagI	CCTNNNNNAGG	1 cut(s)	103

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.