RchiOBHm_Chr5g0072591

histidine-containing phosphotransfer protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
78652543 .. 78652992
450 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ34755

Sequence Viewer

Length: 141 bp
ATGCATCAGTTCAAGGGAAGTAGCGCAAGCATCAGAACCAAAAAGGTGAAAGCTGAATGCCAACAGTTCAGGGAATATTGTAGGGCAGGAAATGGAGAATGGTTATTGTTTGGAACAGCACACGAGAGGATCAGAGGATGA

Protein Analysis

46

Amino Acids

5.31

Weight (kDa)

9.89

Isoelectric Point (pI)

14.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 137
AgsI TTSAA 1 cut(s) 13
AluBI AGCT 1 cut(s) 53
AluI AGCT 1 cut(s) 53
AlwI GGATC 1 cut(s) 137
AspLEI GCGC 1 cut(s) 26
AsuHPI GGTGA 1 cut(s) 58
BauI CACGAG 1 cut(s) 122
BmsI GCATC 2 cut(s) 13, 39
BsmI GAATGC 1 cut(s) 62
Bsp143I GATC 1 cut(s) 129
BspPI GGATC 1 cut(s) 137
BssMI GATC 1 cut(s) 129
BssSI CACGAG 1 cut(s) 122
Bst2BI CACGAG 1 cut(s) 122
Bst4CI ACNGT 1 cut(s) 66
BstC8I GCNNGC 1 cut(s) 28
BstHHI GCGC 1 cut(s) 26
BstKTI GATC 1 cut(s) 132
BstMBI GATC 1 cut(s) 129
Cac8I GCNNGC 1 cut(s) 28
CfoI GCGC 1 cut(s) 26
CviJI RGCY 1 cut(s) 53
CviKI_1 RGCY 1 cut(s) 53
DpnI GATC 1 cut(s) 131
DpnII GATC 1 cut(s) 129
EcoT22I ATGCAT 1 cut(s) 6
GlaI GCGC 1 cut(s) 25
HhaI GCGC 1 cut(s) 26
Hin6I GCGC 1 cut(s) 24
HinP1I GCGC 1 cut(s) 24
HphI GGTGA 1 cut(s) 58
Hpy188I TCNGA 2 cut(s) 35, 134
HpyCH4III ACNGT 1 cut(s) 66
HpyCH4V TGCA 1 cut(s) 4
HspAI GCGC 1 cut(s) 24
Kzo9I GATC 1 cut(s) 129
LpnPI CCDG 2 cut(s) 55, 72
LweI GCATC 2 cut(s) 13, 39
MalI GATC 1 cut(s) 131
MboI GATC 1 cut(s) 129
MnlI CCTC 2 cut(s) 120, 128
Mph1103I ATGCAT 1 cut(s) 6
Mva1269I GAATGC 1 cut(s) 62
NdeII GATC 1 cut(s) 129
NsiI ATGCAT 1 cut(s) 6
PctI GAATGC 1 cut(s) 62
Sau3AI GATC 1 cut(s) 129
SetI ASST 2 cut(s) 48, 55
SfaNI GCATC 2 cut(s) 13, 39
SgeI CNNG 6 cut(s) 25, 39, 82, 99, 134, 136
SspI AATATT 1 cut(s) 77
TaaI ACNGT 1 cut(s) 66
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.