RchiOBHm_Chr5g0078431

Protein POLLEN DEFECTIVE IN GUIDANCE

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
84302614 .. 84307870
5257 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35296

Sequence Viewer

Length: 210 bp
ATGGCGTTGAGATCGGGCGGCTGGAAGCTATCGTTCGTGTTCTCGTTCGTTTCTCTTGATGTTGACTATCATACCAACAAGAATTTTGATTACCCTGTGGAGGCTTGTGCATACAAGGCAGTTAAGAGGCCATCTGCAGCAGAGCTGTCTGATTTTGGGTGTTTTACAATAATGGCTTGTGGTGTCATTCTTTTGCAGCAAACAGCTTAA

Protein Analysis

69

Amino Acids

7.63

Weight (kDa)

6.51

Isoelectric Point (pI)

60.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 18
AcsI RAATTY 1 cut(s) 82
AfiI CCNNNNNNNGG 1 cut(s) 100
AluBI AGCT 3 cut(s) 28, 145, 206
AluI AGCT 3 cut(s) 28, 145, 206
AoxI GGCC 1 cut(s) 128
ApeKI GCWGC 2 cut(s) 137, 196
ApoI RAATTY 1 cut(s) 82
BbvI GCAGC 1 cut(s) 149
BccI CCATC 1 cut(s) 139
BfmI CTRYAG 1 cut(s) 135
BisI GCNGC 3 cut(s) 19, 138, 197
BlsI GCNGC 3 cut(s) 20, 139, 198
Bsc4I CCNNNNNNNGG 1 cut(s) 100
BseLI CCNNNNNNNGG 1 cut(s) 100
BseXI GCAGC 1 cut(s) 149
BshFI GGCC 1 cut(s) 130
BslI CCNNNNNNNGG 1 cut(s) 100
BsnI GGCC 1 cut(s) 130
Bsp143I GATC 1 cut(s) 11
BspACI CCGC 1 cut(s) 18
BspANI GGCC 1 cut(s) 130
BspMAI CTGCAG 1 cut(s) 139
BssMI GATC 1 cut(s) 11
BstKTI GATC 1 cut(s) 14
BstMBI GATC 1 cut(s) 11
BstMWI GCNNNNNNNGC 1 cut(s) 116
BstSFI CTRYAG 1 cut(s) 135
BstV1I GCAGC 1 cut(s) 149
BsuRI GGCC 1 cut(s) 130
CviJI RGCY 7 cut(s) 21, 28, 104, 130, 145, 176, 206
CviKI_1 RGCY 7 cut(s) 21, 28, 104, 130, 145, 176, 206
DpnI GATC 1 cut(s) 13
DpnII GATC 1 cut(s) 11
FaiI YATR 2 cut(s) 72, 112
Fnu4HI GCNGC 3 cut(s) 19, 138, 197
Fsp4HI GCNGC 3 cut(s) 19, 138, 197
GluI GCNGC 3 cut(s) 19, 138, 197
HaeIII GGCC 1 cut(s) 130
HincII GTYRAC 1 cut(s) 64
HindII GTYRAC 1 cut(s) 64
Hpy166II GTNNAC 1 cut(s) 64
Hpy188I TCNGA 1 cut(s) 151
Hpy188III TCNNGA 1 cut(s) 56
Hpy8I GTNNAC 1 cut(s) 64
HpyCH4V TGCA 3 cut(s) 110, 137, 196
HpyF10VI GCNNNNNNNGC 1 cut(s) 116
Kzo9I GATC 1 cut(s) 11
LpnPI CCDG 2 cut(s) 7, 108
Lsp1109I GCAGC 1 cut(s) 149
MalI GATC 1 cut(s) 13
MboI GATC 1 cut(s) 11
MluCI AATT 1 cut(s) 82
MnlI CCTC 2 cut(s) 94, 120
MseI TTAA 2 cut(s) 123, 208
MwoI GCNNNNNNNGC 1 cut(s) 116
NdeII GATC 1 cut(s) 11
PkrI GCNGC 3 cut(s) 20, 139, 198
PstI CTGCAG 1 cut(s) 139
SaqAI TTAA 2 cut(s) 123, 208
SatI GCNGC 3 cut(s) 19, 138, 197
Sau3AI GATC 1 cut(s) 11
SetI ASST 3 cut(s) 30, 147, 208
SfcI CTRYAG 1 cut(s) 135
Sse9I AATT 1 cut(s) 82
SsiI CCGC 1 cut(s) 18
TasI AATT 1 cut(s) 82
TauI GCSGC 1 cut(s) 21
Tru1I TTAA 2 cut(s) 123, 208
Tru9I TTAA 2 cut(s) 123, 208
TseI GCWGC 2 cut(s) 137, 196
XapI RAATTY 1 cut(s) 82
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.