Rh6CG132300

Protein POLLEN DEFECTIVE IN GUIDANCE

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
16087534 .. 16088020
487 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG132300.1

Sequence Viewer

Length: 234 bp
ATGTCTAATGGGAATTCATTACGGAGCACAACAACCCTTGGCAATGAGAAACAAAGAGAGAGGGTTTATGATACTATCTTTATCTTACCTTGGAGATGTGAATTTCTGATAGATGTTGGCTTTTTCATGTGTTTTGATTCGTTTCTCCCGCTGTTCACTATCATGCCAACAATAATTTTGATTACCCTGTGGAGGCTTATGCATACAAGGCAGTTAAGAGGCCATCTGCAGTAG

Protein Analysis

77

Amino Acids

9.18

Weight (kDa)

8.88

Isoelectric Point (pI)

58.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 149
AcsI RAATTY 2 cut(s) 13, 101
AfiI CCNNNNNNNGG 1 cut(s) 192
Alw21I GWGCWC 1 cut(s) 29
AoxI GGCC 1 cut(s) 220
ApoI RAATTY 2 cut(s) 13, 101
Bbv12I GWGCWC 1 cut(s) 29
BccI CCATC 1 cut(s) 231
BfmI CTRYAG 1 cut(s) 227
BsaJI CCNNGG 2 cut(s) 37, 89
Bsc4I CCNNNNNNNGG 1 cut(s) 192
Bse3DI GCAATG 1 cut(s) 49
BseDI CCNNGG 2 cut(s) 37, 89
BseLI CCNNNNNNNGG 1 cut(s) 192
BseMI GCAATG 1 cut(s) 49
BshFI GGCC 1 cut(s) 222
BsiHKAI GWGCWC 1 cut(s) 29
BslI CCNNNNNNNGG 1 cut(s) 192
BsnI GGCC 1 cut(s) 222
Bsp1286I GDGCHC 1 cut(s) 29
BspACI CCGC 1 cut(s) 149
BspANI GGCC 1 cut(s) 222
BspMAI CTGCAG 1 cut(s) 231
BsrDI GCAATG 1 cut(s) 49
BssECI CCNNGG 2 cut(s) 37, 89
BssT1I CCWWGG 2 cut(s) 37, 89
BstMWI GCNNNNNNNGC 1 cut(s) 208
BstSFI CTRYAG 1 cut(s) 227
BsuRI GGCC 1 cut(s) 222
CviAII CATG 2 cut(s) 127, 163
CviJI RGCY 3 cut(s) 120, 196, 222
CviKI_1 RGCY 3 cut(s) 120, 196, 222
Eco130I CCWWGG 2 cut(s) 37, 89
EcoRI GAATTC 1 cut(s) 13
EcoT14I CCWWGG 2 cut(s) 37, 89
EcoT22I ATGCAT 1 cut(s) 204
ErhI CCWWGG 2 cut(s) 37, 89
FaeI CATG 2 cut(s) 130, 166
FaiI YATR 5 cut(s) 69, 128, 164, 200, 204
FatI CATG 2 cut(s) 126, 162
FauI CCCGC 1 cut(s) 156
HaeIII GGCC 1 cut(s) 222
Hin1II CATG 2 cut(s) 130, 166
HinfI GANTC 1 cut(s) 137
Hpy166II GTNNAC 1 cut(s) 156
Hpy188I TCNGA 1 cut(s) 108
Hpy8I GTNNAC 1 cut(s) 156
HpyCH4V TGCA 2 cut(s) 202, 229
HpyF10VI GCNNNNNNNGC 1 cut(s) 208
Hsp92II CATG 2 cut(s) 130, 166
LmnI GCTCC 1 cut(s) 24
LpnPI CCDG 1 cut(s) 200
MhlI GDGCHC 1 cut(s) 29
MluCI AATT 3 cut(s) 13, 101, 174
MnlI CCTC 3 cut(s) 54, 186, 212
Mph1103I ATGCAT 1 cut(s) 204
MseI TTAA 1 cut(s) 215
MslI CAYNNNNRTG 1 cut(s) 161
MspA1I CMGCKG 1 cut(s) 151
MwoI GCNNNNNNNGC 1 cut(s) 208
NlaIII CATG 2 cut(s) 130, 166
NsiI ATGCAT 1 cut(s) 204
PfeI GAWTC 1 cut(s) 137
PstI CTGCAG 1 cut(s) 231
RseI CAYNNNNRTG 1 cut(s) 161
SaqAI TTAA 1 cut(s) 215
SduI GDGCHC 1 cut(s) 29
SetI ASST 1 cut(s) 91
SfcI CTRYAG 1 cut(s) 227
SgeI CNNG 7 cut(s) 50, 102, 139, 160, 175, 199, 219
SmiMI CAYNNNNRTG 1 cut(s) 161
Sse9I AATT 3 cut(s) 13, 101, 174
SsiI CCGC 1 cut(s) 149
StyI CCWWGG 2 cut(s) 37, 89
TasI AATT 3 cut(s) 13, 101, 174
TfiI GAWTC 1 cut(s) 137
Tru1I TTAA 1 cut(s) 215
Tru9I TTAA 1 cut(s) 215
TspDTI ATGAA 2 cut(s) 6, 115
TspGWI ACGGA 1 cut(s) 37
XapI RAATTY 2 cut(s) 13, 101
Zsp2I ATGCAT 1 cut(s) 204
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.