Rroxscaffold_3G00248840

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0000972
Physical Location & Seq
Reverse (-)
42299645 .. 42301937
2293 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00248840.1

Sequence Viewer

Length: 228 bp
ATGATCGAATTAAGGGAAAAGGAAGCAGCAACAACAAGAGACAGAGACATTGGAAAGGGAGAGAAAGAGGAAAAGGTCCAAGGCCCAAATATGCAATTATTGGATTTAACACTTCTCGGTTTCTATGGGACAGATGAAGGATTGTCTTTGTTCTTTCAGATATACATGATAGTTAGTATTGATGCTTATCTGATAATTATCAGCGTTTTACGAATTGATTGGGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.64

Weight (kDa)

4.46

Isoelectric Point (pI)

25.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Alw26I GTCTC 2 cut(s) 33, 39
AoxI GGCC 1 cut(s) 82
ApeKI GCWGC 1 cut(s) 26
AspS9I GGNCC 2 cut(s) 76, 83
AvaII GGWCC 1 cut(s) 76
BbvI GCAGC 1 cut(s) 38
BcoDI GTCTC 2 cut(s) 33, 39
BisI GCNGC 1 cut(s) 27
BlsI GCNGC 1 cut(s) 28
Bme18I GGWCC 1 cut(s) 76
BmgT120I GGNCC 2 cut(s) 76, 83
BmsI GCATC 1 cut(s) 172
BsaBI GATNNNNATC 2 cut(s) 186, 197
BsaJI CCNNGG 1 cut(s) 79
Bse8I GATNNNNATC 2 cut(s) 186, 197
BseDI CCNNGG 1 cut(s) 79
BseJI GATNNNNATC 2 cut(s) 186, 197
BseXI GCAGC 1 cut(s) 38
BshFI GGCC 1 cut(s) 84
BslFI GGGAC 1 cut(s) 142
BsmAI GTCTC 2 cut(s) 33, 39
BsmFI GGGAC 1 cut(s) 142
BsnI GGCC 1 cut(s) 84
Bsp143I GATC 1 cut(s) 3
BspANI GGCC 1 cut(s) 84
BssECI CCNNGG 1 cut(s) 79
BssMI GATC 1 cut(s) 3
BssT1I CCWWGG 1 cut(s) 79
BstKTI GATC 1 cut(s) 6
BstMAI GTCTC 2 cut(s) 33, 39
BstMBI GATC 1 cut(s) 3
BstV1I GCAGC 1 cut(s) 38
BsuRI GGCC 1 cut(s) 84
Cfr13I GGNCC 2 cut(s) 76, 83
CviAII CATG 1 cut(s) 166
CviJI RGCY 1 cut(s) 84
CviKI_1 RGCY 1 cut(s) 84
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
Eco130I CCWWGG 1 cut(s) 79
Eco47I GGWCC 1 cut(s) 76
EcoT14I CCWWGG 1 cut(s) 79
ErhI CCWWGG 1 cut(s) 79
FaeI CATG 1 cut(s) 169
FaiI YATR 4 cut(s) 92, 126, 163, 167
FaqI GGGAC 1 cut(s) 142
FatI CATG 1 cut(s) 165
Fnu4HI GCNGC 1 cut(s) 27
Fsp4HI GCNGC 1 cut(s) 27
GluI GCNGC 1 cut(s) 27
HaeIII GGCC 1 cut(s) 84
Hin1II CATG 1 cut(s) 169
Hpy188I TCNGA 2 cut(s) 159, 192
HpyAV CCTTC 1 cut(s) 131
HpyCH4V TGCA 1 cut(s) 94
Hsp92II CATG 1 cut(s) 169
Kzo9I GATC 1 cut(s) 3
Lsp1109I GCAGC 1 cut(s) 38
LweI GCATC 1 cut(s) 172
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MluCI AATT 4 cut(s) 8, 95, 195, 213
MnlI CCTC 1 cut(s) 61
MseI TTAA 2 cut(s) 11, 107
NdeII GATC 1 cut(s) 3
NlaIII CATG 1 cut(s) 169
PkrI GCNGC 1 cut(s) 28
PspPI GGNCC 2 cut(s) 76, 83
SaqAI TTAA 2 cut(s) 11, 107
SatI GCNGC 1 cut(s) 27
Sau3AI GATC 1 cut(s) 3
Sau96I GGNCC 2 cut(s) 76, 83
SetI ASST 1 cut(s) 78
SfaNI GCATC 1 cut(s) 172
SgeI CNNG 4 cut(s) 48, 92, 128, 178
SinI GGWCC 1 cut(s) 76
Sse9I AATT 4 cut(s) 8, 95, 195, 213
StyI CCWWGG 1 cut(s) 79
TaqI TCGA 1 cut(s) 6
TasI AATT 4 cut(s) 8, 95, 195, 213
Tru1I TTAA 2 cut(s) 11, 107
Tru9I TTAA 2 cut(s) 11, 107
TseI GCWGC 1 cut(s) 26
TspDTI ATGAA 1 cut(s) 150
VpaK11BI GGWCC 1 cut(s) 76
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.