Rroxscaffold_7G00183810

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0000972
Physical Location & Seq
Forward (+)
22984926 .. 22987986
3061 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00183810.1

Sequence Viewer

Length: 267 bp
ATGATCCAACTAATGACTCCAAAAGAATTGAACGAGGAACTCATTTTCAATGCCGCAAAAGATCACAAGCCCGCCACCACGCAAAGAAGACTTAAGAAGAAGAAGAGGGCTGTCGCGAATTGCTCCACATTGAAGAGTCCGACTGCTGCGAATGACGATACCGATGAGAATGACGTAATATATTGGAATTCAATTACAGCCGGACGGTGTTGTGCTCCATCACGACGGAGGTCGGCGACTAGAATAATTTTGTCGAGCCAGAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

9.9

Weight (kDa)

9.78

Isoelectric Point (pI)

59.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 116
AciI CCGC 2 cut(s) 54, 72
AcsI RAATTY 1 cut(s) 187
AflII CTTAAG 1 cut(s) 92
AgsI TTSAA 4 cut(s) 31, 49, 133, 192
Alw21I GWGCWC 1 cut(s) 217
ApeKI GCWGC 1 cut(s) 146
ApoI RAATTY 1 cut(s) 187
BbsI GAAGAC 1 cut(s) 94
Bbv12I GWGCWC 1 cut(s) 217
BbvI GCAGC 1 cut(s) 133
BccI CCATC 1 cut(s) 226
BfaI CTAG 1 cut(s) 240
BfrI CTTAAG 1 cut(s) 92
BisI GCNGC 2 cut(s) 54, 147
BlsI GCNGC 2 cut(s) 55, 148
BoxI GACNNNNGTC 1 cut(s) 229
BpiI GAAGAC 1 cut(s) 94
BseXI GCAGC 1 cut(s) 133
Bsh1236I CGCG 1 cut(s) 116
BsiHKAI GWGCWC 1 cut(s) 217
BsiSI CCGG 1 cut(s) 201
Bsp1286I GDGCHC 1 cut(s) 217
Bsp143I GATC 2 cut(s) 3, 61
Bsp68I TCGCGA 1 cut(s) 116
BspACI CCGC 2 cut(s) 54, 72
BspFNI CGCG 1 cut(s) 116
BspTI CTTAAG 1 cut(s) 92
BssMI GATC 2 cut(s) 3, 61
Bst4CI ACNGT 1 cut(s) 207
Bst6I CTCTTC 2 cut(s) 98, 128
BstAFI CTTAAG 1 cut(s) 92
BstC8I GCNNGC 1 cut(s) 72
BstFNI CGCG 1 cut(s) 116
BstKTI GATC 2 cut(s) 6, 64
BstMBI GATC 2 cut(s) 3, 61
BstPAI GACNNNNGTC 1 cut(s) 229
BstUI CGCG 1 cut(s) 116
BstV1I GCAGC 1 cut(s) 133
BstV2I GAAGAC 1 cut(s) 94
BtuMI TCGCGA 1 cut(s) 116
Cac8I GCNNGC 1 cut(s) 72
CviJI RGCY 4 cut(s) 70, 110, 200, 258
CviKI_1 RGCY 4 cut(s) 70, 110, 200, 258
DpnI GATC 2 cut(s) 5, 63
DpnII GATC 2 cut(s) 3, 61
Eam1104I CTCTTC 2 cut(s) 98, 128
EarI CTCTTC 2 cut(s) 98, 128
EcoRI GAATTC 1 cut(s) 187
FaiI YATR 1 cut(s) 181
FauI CCCGC 1 cut(s) 79
Fnu4HI GCNGC 2 cut(s) 54, 147
Fsp4HI GCNGC 2 cut(s) 54, 147
FspBI CTAG 1 cut(s) 240
GluI GCNGC 2 cut(s) 54, 147
HapII CCGG 1 cut(s) 201
HinfI GANTC 2 cut(s) 16, 136
HpaII CCGG 1 cut(s) 201
Hpy188I TCNGA 1 cut(s) 141
Hpy188III TCNNGA 2 cut(s) 115, 222
Hpy99I CGWCG 1 cut(s) 228
HpyCH4III ACNGT 1 cut(s) 207
HpyCH4IV ACGT 1 cut(s) 174
HpySE526I ACGT 1 cut(s) 174
Kzo9I GATC 2 cut(s) 3, 61
LmnI GCTCC 2 cut(s) 128, 220
LpnPI CCDG 1 cut(s) 214
Lsp1109I GCAGC 1 cut(s) 133
MaeI CTAG 1 cut(s) 240
MaeII ACGT 1 cut(s) 174
MalI GATC 2 cut(s) 5, 63
MboI GATC 2 cut(s) 3, 61
MboII GAAGA 5 cut(s) 99, 109, 112, 115, 145
MhlI GDGCHC 1 cut(s) 217
MluCI AATT 6 cut(s) 26, 118, 187, 192, 246, 262
MlyI GAGTC 2 cut(s) 10, 145
MmeI TCCRAC 2 cut(s) 31, 164
MnlI CCTC 3 cut(s) 28, 99, 222
MseI TTAA 1 cut(s) 93
MspCI CTTAAG 1 cut(s) 92
MspI CCGG 1 cut(s) 201
MvnI CGCG 1 cut(s) 116
NdeII GATC 2 cut(s) 3, 61
NruI TCGCGA 1 cut(s) 116
PkrI GCNGC 2 cut(s) 55, 148
PleI GAGTC 2 cut(s) 10, 144
PpsI GAGTC 2 cut(s) 10, 144
PshAI GACNNNNGTC 1 cut(s) 229
RruI TCGCGA 1 cut(s) 116
SaqAI TTAA 1 cut(s) 93
SatI GCNGC 2 cut(s) 54, 147
Sau3AI GATC 2 cut(s) 3, 61
SchI GAGTC 2 cut(s) 10, 145
SduI GDGCHC 1 cut(s) 217
SetI ASST 2 cut(s) 177, 233
SgeI CNNG 8 cut(s) 46, 79, 83, 91, 127, 213, 234, 252
SmlI CTYRAG 1 cut(s) 92
SmoI CTYRAG 1 cut(s) 92
Sse9I AATT 6 cut(s) 26, 118, 187, 192, 246, 262
SsiI CCGC 2 cut(s) 54, 72
SspMI CTAG 1 cut(s) 240
TaaI ACNGT 1 cut(s) 207
TaiI ACGT 1 cut(s) 177
TaqI TCGA 1 cut(s) 254
TasI AATT 6 cut(s) 26, 118, 187, 192, 246, 262
TauI GCSGC 1 cut(s) 56
Tru1I TTAA 1 cut(s) 93
Tru9I TTAA 1 cut(s) 93
TseI GCWGC 1 cut(s) 146
TspGWI ACGGA 1 cut(s) 241
Vha464I CTTAAG 1 cut(s) 92
XapI RAATTY 1 cut(s) 187
XspI CTAG 1 cut(s) 240
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.