Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000346.1

Orthogroup ID

OG0000972

Physical Location & Seq

Genomic Coordinates Forward (+)

54233 .. 54625

Gene Structure 393 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000346.1_g000015.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 231 bp

atgggaaactgttttaacatttgggtactgcagaacgctggtgtggtattcgtctgtgaaatgatcatcgatatcgtaaagcactcgttgattgctaagttcaatgacataaagccctttgcatactctgagtttcttgaaggacctatgcaagcagacgttcaaacaggatcaagagctttgcctactttcatcaactatactcgtgatggtatagaggtacatgtatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005783 GO:0005788 GO:0006935 GO:0007275 GO:0008104 GO:0008150 GO:0009605 GO:0009790 GO:0009791 GO:0009793 GO:0009856 GO:0009987 GO:0010154 GO:0010183 GO:0012505 GO:0022414 GO:0031974 GO:0032501 GO:0032502 GO:0032507 GO:0033036 GO:0033365 GO:0034613 GO:0035437 GO:0040011 GO:0042221 GO:0042330 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0044422 GO:0044424 GO:0044432 GO:0044444 GO:0044446 GO:0044464 GO:0044706 GO:0045185 GO:0048316 GO:0048608 GO:0048731 GO:0048856 GO:0048868 GO:0050896 GO:0050918 GO:0051179 GO:0051235 GO:0051641 GO:0051651 GO:0051704 GO:0061458 GO:0065007 GO:0065008 GO:0070013 GO:0070727 GO:0070972 GO:0072595

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF747

Protein Analysis

76

Amino Acids

8.56

Weight (kDa)

5.04

Isoelectric Point (pI)

24.81

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000972)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G67960
fragaria_vesca	FvH4_4g33240 FvH4_4g33240 FvH4_4g33240 FvH4_4g33240 FvH4_4g33240 FvH4_4g33240 FvH4_4g33240 FvH4_4g33240 FvH4_4g33240 FvH4_4g33240 FvH4_4g33240 FvH4_4g33240 FvH4_4g33240
malus_domestica	MD13G1017500.v1.1 MD13G1017700.v1.1 MD16G1015700.v1.1
prunus_persica	Prupe.1G335900_v2.0.a1 Prupe.1G335900_v2.0.a1 Prupe.1G335900_v2.0.a1
pyrus_communis	pycom13g01510 pycom13g01520 pycom16g01460
rosa_chinensis	RchiOBHm_Chr2g0114371 RchiOBHm_Chr4g0390701 RchiOBHm_Chr4g0442391 RchiOBHm_Chr5g0078431 RchiOBHm_Chr6g0287871
rosa_laevigata	RLG00000017993 RLG00000020662 RLG00000032414
rosa_multiflora	Rmu_sc0000346.1_g000015 Rmu_sc0006380.1_g000001 Rmu_sc0006478.1_g000002 Rmu_sc0036628.1_g000001 Rmu_ssc0000204.1_g000063
rosa_roxburghii	Rroxscaffold_2G00081610 Rroxscaffold_3G00248840 Rroxscaffold_5G00383240 Rroxscaffold_7G00183810
rosa_rugosa	Rorug04G0340800
rosa_samantha	Rh1AG155700 Rh1AG281100 Rh1CG145900 Rh2BG511100 Rh2BG570500 Rh2CG250700 Rh2DG255000 Rh2DG522900 Rh4AG033000 Rh4AG392400 Rh4BG026900 Rh4BG406100 Rh4CG421200 Rh4DG399200 Rh5AG369200 Rh5DG164900 Rh6BG139300 Rh6CG132300 Rh6DG122800 Rh7DG359500
rosa_wichuraiana	Rw2G010190 Rw4G033890

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	178
AfaI	GTAC	2 cut(s)	27, 222
AflIII	ACRYGT	1 cut(s)	223
AgsI	TTSAA	3 cut(s)	103, 140, 164
AluBI	AGCT	1 cut(s)	179
AluI	AGCT	1 cut(s)	179
AlwI	GGATC	1 cut(s)	178
AspS9I	GGNCC	1 cut(s)	143
AvaII	GGWCC	1 cut(s)	143
BauI	CACGAG	1 cut(s)	204
BccI	CCATC	1 cut(s)	203
BclI	TGATCA	1 cut(s)	63
BfmI	CTRYAG	1 cut(s)	29
Bme18I	GGWCC	1 cut(s)	143
BmgT120I	GGNCC	1 cut(s)	143
Bsa29I	ATCGAT	1 cut(s)	69
BseCI	ATCGAT	1 cut(s)	69
BseMII	CTCAG	1 cut(s)	120
BshVI	ATCGAT	1 cut(s)	69
Bsp143I	GATC	2 cut(s)	63, 170
BspCNI	CTCAG	1 cut(s)	121
BspDI	ATCGAT	1 cut(s)	69
BspMAI	CTGCAG	1 cut(s)	33
BspPI	GGATC	1 cut(s)	178
BssMI	GATC	2 cut(s)	63, 170
BssSI	CACGAG	1 cut(s)	204
Bst2BI	CACGAG	1 cut(s)	204
Bst4CI	ACNGT	1 cut(s)	11
BstC8I	GCNNGC	1 cut(s)	153
BstDEI	CTNAG	2 cut(s)	96, 129
BstKTI	GATC	2 cut(s)	66, 173
BstMBI	GATC	2 cut(s)	63, 170
BstNSI	RCATGY	1 cut(s)	227
BstSFI	CTRYAG	1 cut(s)	29
Bsu15I	ATCGAT	1 cut(s)	69
BsuTUI	ATCGAT	1 cut(s)	69
Cac8I	GCNNGC	1 cut(s)	153
Cfr13I	GGNCC	1 cut(s)	143
ClaI	ATCGAT	1 cut(s)	69
Csp6I	GTAC	2 cut(s)	26, 221
CviAII	CATG	1 cut(s)	224
CviJI	RGCY	2 cut(s)	115, 179
CviKI_1	RGCY	2 cut(s)	115, 179
CviQI	GTAC	2 cut(s)	26, 221
DdeI	CTNAG	2 cut(s)	96, 129
DpnI	GATC	2 cut(s)	65, 172
DpnII	GATC	2 cut(s)	63, 170
Eco32I	GATATC	1 cut(s)	73
Eco47I	GGWCC	1 cut(s)	143
EcoO109I	RGGNCCY	1 cut(s)	143
EcoRV	GATATC	1 cut(s)	73
FaeI	CATG	1 cut(s)	227
FaiI	YATR	7 cut(s)	110, 124, 149, 201, 215, 225, 229
FatI	CATG	1 cut(s)	223
FbaI	TGATCA	1 cut(s)	63
Hin1II	CATG	1 cut(s)	227
Hpy188I	TCNGA	1 cut(s)	130
Hpy188III	TCNNGA	3 cut(s)	137, 174, 206
HpyAV	CCTTC	1 cut(s)	134
HpyCH4III	ACNGT	1 cut(s)	11
HpyCH4IV	ACGT	1 cut(s)	159
HpyCH4V	TGCA	3 cut(s)	31, 122, 151
HpyF3I	CTNAG	2 cut(s)	96, 129
HpySE526I	ACGT	1 cut(s)	159
Hsp92II	CATG	1 cut(s)	227
Ksp22I	TGATCA	1 cut(s)	63
Kzo9I	GATC	2 cut(s)	63, 170
LpnPI	CCDG	2 cut(s)	24, 153
MaeII	ACGT	1 cut(s)	159
MalI	GATC	2 cut(s)	65, 172
MboI	GATC	2 cut(s)	63, 170
MnlI	CCTC	1 cut(s)	211
MseI	TTAA	1 cut(s)	15
NdeII	GATC	2 cut(s)	63, 170
NlaIII	CATG	1 cut(s)	227
NspI	RCATGY	1 cut(s)	227
PciI	ACATGT	1 cut(s)	223
PpuMI	RGGWCCY	1 cut(s)	143
PscI	ACATGT	1 cut(s)	223
Psp5II	RGGWCCY	1 cut(s)	143
PspPI	GGNCC	1 cut(s)	143
PspPPI	RGGWCCY	1 cut(s)	143
PstI	CTGCAG	1 cut(s)	33
RsaI	GTAC	2 cut(s)	27, 222
RsaNI	GTAC	2 cut(s)	26, 221
SaqAI	TTAA	1 cut(s)	15
Sau3AI	GATC	2 cut(s)	63, 170
Sau96I	GGNCC	1 cut(s)	143
SetI	ASST	4 cut(s)	148, 162, 181, 222
SfcI	CTRYAG	1 cut(s)	29
SgeI	CNNG	8 cut(s)	51, 97, 149, 164, 180, 186, 216, 218
SinI	GGWCC	1 cut(s)	143
TaaI	ACNGT	1 cut(s)	11
TaiI	ACGT	1 cut(s)	162
TaqI	TCGA	1 cut(s)	69
Tru1I	TTAA	1 cut(s)	15
Tru9I	TTAA	1 cut(s)	15
TspDTI	ATGAA	1 cut(s)	181
VpaK11BI	GGWCC	1 cut(s)	143
XceI	RCATGY	1 cut(s)	227

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.