Rroxscaffold_2G00081610

alpha-mannosidase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
4667071 .. 4667432
362 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00081610.1

Sequence Viewer

Length: 159 bp
ATGTCGTATCTGGAAAGGTGGTGGAGAGACTCCTCGGATGACAAAAGAGAATTGTTCACCAATCTGGTAAAGAATGGTCAGCTAGAAATTGTTGGAGGTGGCTGGGTGATGAATGATGAGGCTAATTCACATTACTATGCCATAATTGAACAGGTATGA

Protein Analysis

52

Amino Acids

6.16

Weight (kDa)

4.6

Isoelectric Point (pI)

66.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro_38N PF01074 1 - 52 1.2e-14 Glycosyl hydrolases family 38 N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 149
AluBI AGCT 1 cut(s) 82
AluI AGCT 1 cut(s) 82
Alw26I GTCTC 1 cut(s) 21
AsuHPI GGTGA 2 cut(s) 49, 118
BcoDI GTCTC 1 cut(s) 21
BfaI CTAG 1 cut(s) 83
BsaJI CCNNGG 1 cut(s) 33
BseDI CCNNGG 1 cut(s) 33
BseGI GGATG 1 cut(s) 43
BseRI GAGGAG 1 cut(s) 22
BseYI CCCAGC 1 cut(s) 102
BsmAI GTCTC 1 cut(s) 21
BssECI CCNNGG 1 cut(s) 33
BstF5I GGATG 1 cut(s) 43
BstMAI GTCTC 1 cut(s) 21
BtsCI GGATG 1 cut(s) 43
CviJI RGCY 3 cut(s) 82, 102, 122
CviKI_1 RGCY 3 cut(s) 82, 102, 122
FaiI YATR 3 cut(s) 138, 143, 157
FokI GGATG 1 cut(s) 50
FspBI CTAG 1 cut(s) 83
GsaI CCCAGC 1 cut(s) 106
HinfI GANTC 1 cut(s) 29
HphI GGTGA 2 cut(s) 49, 118
Hpy166II GTNNAC 1 cut(s) 57
Hpy188I TCNGA 1 cut(s) 37
Hpy188III TCNNGA 1 cut(s) 11
Hpy8I GTNNAC 1 cut(s) 57
LpnPI CCDG 3 cut(s) 50, 88, 137
MaeI CTAG 1 cut(s) 83
MluCI AATT 4 cut(s) 50, 87, 124, 144
MlyI GAGTC 1 cut(s) 23
MmeI TCCRAC 1 cut(s) 73
MnlI CCTC 3 cut(s) 43, 89, 112
MslI CAYNNNNRTG 1 cut(s) 135
PleI GAGTC 1 cut(s) 23
PpsI GAGTC 1 cut(s) 23
PspFI CCCAGC 1 cut(s) 102
RseI CAYNNNNRTG 1 cut(s) 135
SchI GAGTC 1 cut(s) 23
SetI ASST 4 cut(s) 20, 84, 100, 156
SgeI CNNG 5 cut(s) 23, 46, 77, 95, 115
SmiMI CAYNNNNRTG 1 cut(s) 135
Sse9I AATT 4 cut(s) 50, 87, 124, 144
SspMI CTAG 1 cut(s) 83
TasI AATT 4 cut(s) 50, 87, 124, 144
TspDTI ATGAA 1 cut(s) 125
XspI CTAG 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.