RLG00000015570

Aminotransferase class-V

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr3
Physical Location & Seq
Forward (+)
67953278 .. 67953946
669 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000015570

Sequence Viewer

Length: 669 bp
ATGATTGATCATGTTACATCCAGGCCATCTGTTGTACTTCCAGTTAAGAAATTGGTTAAACTTTGCAGGGAAGAAGGTATTGATCAAGTTGACATGCAAGAAATTGGGGCAGATTTTTACACTAGTAATTTGCACAAGTGGTTCTTCTCCCCTGCTTCGGTTGCATTTTTATATTGTAGGAAGTCAGTCACACATTTAGAATTGCATCATCCTATGGTGTCTCATGACTATGGTAAAGGGTTGGCTATTGAAAGTAGATGGATAGGGACTAGGGATTATAGTCCTTCTTTAGTGGTTCCTTCAGTTGTGGAGTTCACAAATAGGTTTGAAGGAGGTATTGAGGGAATCAAAAGGAGGAATCATGATGCTGTTGTTGTGATGGGTAAGATGTTGGCAAAGGCTTGGGGAACCAATCTTGGGTCTCCGCCAGATATGTGTGCAAGCATGATCATGGTGGGATTACTGGCTTGTTTGGAGGTTTCAAGTGATGATGATGCTTTGAAGTTAAGGACACATATATTGCCATATGCCAAAACATTAAGAAGTGGCAAAAACAACAGGATGCTCGAGTTTCTCATCCAGTCTACAACAAAGTTGATGACTATTATAAGTTCAGAGATGCAATTAATCAGCTTGTTTGTGATGGGTTCACCTGTGCTTGATCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

223

Amino Acids

24.81

Weight (kDa)

7.73

Isoelectric Point (pI)

50.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 608
AccI GTMKAC 1 cut(s) 584
AciI CCGC 1 cut(s) 425
AcuI CTGAAG 1 cut(s) 285
AfaI GTAC 1 cut(s) 36
AfiI CCNNNNNNNGG 2 cut(s) 157, 417
AgsI TTSAA 4 cut(s) 251, 329, 483, 502
AhlI ACTAGT 1 cut(s) 122
AjnI CCWGG 1 cut(s) 20
AluBI AGCT 1 cut(s) 633
AluI AGCT 1 cut(s) 633
Alw26I GTCTC 2 cut(s) 225, 426
Ama87I CYCGRG 1 cut(s) 566
AoxI GGCC 1 cut(s) 23
AseI ATTAAT 1 cut(s) 626
AsuHPI GGTGA 1 cut(s) 642
AvaI CYCGRG 1 cut(s) 566
BccI CCATC 4 cut(s) 34, 252, 373, 637
BciT130I CCWGG 1 cut(s) 22
BclI TGATCA 3 cut(s) 7, 82, 447
BcoDI GTCTC 2 cut(s) 225, 426
BcuI ACTAGT 1 cut(s) 122
BfaI CTAG 2 cut(s) 123, 270
Bme1390I CCNGG 1 cut(s) 22
BmeT110I CYCGRG 1 cut(s) 566
BmiI GGNNCC 2 cut(s) 297, 409
BmrFI CCNGG 1 cut(s) 22
BmsI GCATC 5 cut(s) 214, 355, 484, 552, 609
BsaI GGTCTC 1 cut(s) 426
Bsc4I CCNNNNNNNGG 2 cut(s) 157, 417
Bse1I ACTGG 3 cut(s) 41, 468, 580
BseBI CCWGG 1 cut(s) 22
BseGI GGATG 4 cut(s) 17, 208, 567, 576
BseLI CCNNNNNNNGG 2 cut(s) 157, 417
BseNI ACTGG 3 cut(s) 41, 468, 580
BshFI GGCC 1 cut(s) 25
BsiHKCI CYCGRG 1 cut(s) 566
BslFI GGGAC 1 cut(s) 280
BslI CCNNNNNNNGG 2 cut(s) 157, 417
BsmAI GTCTC 2 cut(s) 225, 426
BsmFI GGGAC 1 cut(s) 280
BsnI GGCC 1 cut(s) 25
Bso31I GGTCTC 1 cut(s) 426
BsoBI CYCGRG 1 cut(s) 566
Bsp143I GATC 4 cut(s) 7, 82, 447, 661
BspACI CCGC 1 cut(s) 425
BspANI GGCC 1 cut(s) 25
BspHI TCATGA 2 cut(s) 223, 361
BspLI GGNNCC 2 cut(s) 297, 409
BspTNI GGTCTC 1 cut(s) 426
BsrI ACTGG 3 cut(s) 41, 468, 580
BssMI GATC 4 cut(s) 7, 82, 447, 661
Bst2UI CCWGG 1 cut(s) 22
BstC8I GCNNGC 1 cut(s) 442
BstF5I GGATG 4 cut(s) 17, 208, 567, 576
BstKTI GATC 4 cut(s) 10, 85, 450, 664
BstMAI GTCTC 2 cut(s) 225, 426
BstMBI GATC 4 cut(s) 7, 82, 447, 661
BstMWI GCNNNNNNNGC 1 cut(s) 161
BstNI CCWGG 1 cut(s) 22
BstNSI RCATGY 1 cut(s) 97
BstSCI CCNGG 1 cut(s) 20
BsuRI GGCC 1 cut(s) 25
BtsCI GGATG 4 cut(s) 17, 208, 567, 576
Cac8I GCNNGC 1 cut(s) 442
CciI TCATGA 2 cut(s) 223, 361
Csp6I GTAC 1 cut(s) 35
CviAII CATG 6 cut(s) 11, 94, 224, 362, 445, 451
CviJI RGCY 5 cut(s) 25, 245, 401, 467, 633
CviKI_1 RGCY 5 cut(s) 25, 245, 401, 467, 633
CviQI GTAC 1 cut(s) 35
DpnI GATC 4 cut(s) 9, 84, 449, 663
DpnII GATC 4 cut(s) 7, 82, 447, 661
EciI GGCGGA 1 cut(s) 414
Eco31I GGTCTC 1 cut(s) 426
Eco57I CTGAAG 1 cut(s) 285
Eco88I CYCGRG 1 cut(s) 566
EcoRII CCWGG 1 cut(s) 20
FaeI CATG 6 cut(s) 14, 97, 227, 365, 448, 454
FalI AAGNNNNNCTT 2 cut(s) 128, 160
FaqI GGGAC 1 cut(s) 280
FatI CATG 6 cut(s) 10, 93, 223, 361, 444, 450
FauNDI CATATG 1 cut(s) 526
FbaI TGATCA 3 cut(s) 7, 82, 447
FblI GTMKAC 1 cut(s) 584
FokI GGATG 4 cut(s) 4, 195, 563, 574
FspBI CTAG 2 cut(s) 123, 270
HaeIII GGCC 1 cut(s) 25
Hin1II CATG 6 cut(s) 14, 97, 227, 365, 448, 454
HincII GTYRAC 1 cut(s) 91
HindII GTYRAC 1 cut(s) 91
HinfI GANTC 2 cut(s) 345, 358
HphI GGTGA 1 cut(s) 642
Hpy166II GTNNAC 4 cut(s) 91, 315, 585, 650
Hpy188I TCNGA 1 cut(s) 616
Hpy188III TCNNGA 2 cut(s) 224, 362
Hpy8I GTNNAC 4 cut(s) 91, 315, 585, 650
HpyAV CCTTC 4 cut(s) 68, 294, 309, 323
HpyCH4V TGCA 7 cut(s) 66, 97, 133, 164, 205, 440, 622
HpyF10VI GCNNNNNNNGC 1 cut(s) 161
Hsp92II CATG 6 cut(s) 14, 97, 227, 365, 448, 454
Ksp22I TGATCA 3 cut(s) 7, 82, 447
Kzo9I GATC 4 cut(s) 7, 82, 447, 661
LpnPI CCDG 9 cut(s) 7, 34, 52, 54, 165, 441, 449, 544, 593
LweI GCATC 5 cut(s) 214, 355, 484, 552, 609
MaeI CTAG 2 cut(s) 123, 270
MaeIII GTNAC 2 cut(s) 13, 187
MalI GATC 4 cut(s) 9, 84, 449, 663
MboI GATC 4 cut(s) 7, 82, 447, 661
MboII GAAGA 2 cut(s) 83, 136
MluCI AATT 5 cut(s) 50, 102, 127, 200, 623
MnlI CCTC 4 cut(s) 326, 334, 348, 469
MseI TTAA 5 cut(s) 45, 57, 506, 539, 626
MslI CAYNNNNRTG 2 cut(s) 228, 449
MspR9I CCNGG 1 cut(s) 22
MvaI CCWGG 1 cut(s) 22
MwoI GCNNNNNNNGC 1 cut(s) 161
NdeI CATATG 1 cut(s) 526
NdeII GATC 4 cut(s) 7, 82, 447, 661
NlaIII CATG 6 cut(s) 14, 97, 227, 365, 448, 454
NlaIV GGNNCC 2 cut(s) 297, 409
NmuCI GTSAC 1 cut(s) 187
NspI RCATGY 1 cut(s) 97
PaeR7I CTCGAG 1 cut(s) 566
PagI TCATGA 2 cut(s) 223, 361
PfeI GAWTC 2 cut(s) 345, 358
PshBI ATTAAT 1 cut(s) 626
PsiI TTATAA 1 cut(s) 608
Psp6I CCWGG 1 cut(s) 20
PspGI CCWGG 1 cut(s) 20
PspN4I GGNNCC 2 cut(s) 297, 409
PspXI VCTCGAGB 1 cut(s) 566
RsaI GTAC 1 cut(s) 36
RsaNI GTAC 1 cut(s) 35
RseI CAYNNNNRTG 2 cut(s) 228, 449
SaqAI TTAA 5 cut(s) 45, 57, 506, 539, 626
Sau3AI GATC 4 cut(s) 7, 82, 447, 661
ScrFI CCNGG 1 cut(s) 22
SetI ASST 6 cut(s) 79, 326, 337, 480, 635, 655
SfaNI GCATC 5 cut(s) 214, 355, 484, 552, 609
Sfr274I CTCGAG 1 cut(s) 566
SlaI CTCGAG 1 cut(s) 566
SmiMI CAYNNNNRTG 2 cut(s) 228, 449
SmlI CTYRAG 1 cut(s) 566
SmoI CTYRAG 1 cut(s) 566
SpeI ACTAGT 1 cut(s) 122
Sse9I AATT 5 cut(s) 50, 102, 127, 200, 623
SsiI CCGC 1 cut(s) 425
SspMI CTAG 2 cut(s) 123, 270
StyD4I CCNGG 1 cut(s) 20
TaqI TCGA 1 cut(s) 567
TasI AATT 5 cut(s) 50, 102, 127, 200, 623
TatI WGTACW 1 cut(s) 34
TfiI GAWTC 2 cut(s) 345, 358
Tru1I TTAA 5 cut(s) 45, 57, 506, 539, 626
Tru9I TTAA 5 cut(s) 45, 57, 506, 539, 626
TseFI GTSAC 1 cut(s) 187
Tsp45I GTSAC 1 cut(s) 187
VspI ATTAAT 1 cut(s) 626
XceI RCATGY 1 cut(s) 97
XhoI CTCGAG 1 cut(s) 566
XmiI GTMKAC 1 cut(s) 584
XspI CTAG 2 cut(s) 123, 270
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.