Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0013809.1

Orthogroup ID

OG0002899

Physical Location & Seq

Genomic Coordinates Reverse (-)

13834 .. 14649

Gene Structure 816 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0013809.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 816 bp

atggctttggtgaaggaaaaggctagtggtagaagagttagattagctatgattgatcatgttacatccatgccatctgttgtacttccagttaagaaattggttaaagtttgcagggaagaaggtgttgatcaagttttcatagatggggctcatggtgttgggtgtgtagatgttgacatgcaagaaattggagcagatttttacactagtaatttgcacaagtggttcttctgccctgcttcggttgcatttttatattgtaggaagtcagtcacacatttagaattgcatcatcctatggtgtctcatgactatggtaaagggttggctattgaaagtagttggataggaactagggattatagtccatctttagtggttccttcagttgtggagttcacaaataggtttgaaggcggtattgagggaatcaaaaggaggaatcatgatgctgttgttgagatgggtaagatgttggcaaaggcttggggaaccaatcttgggtctccaccagatatgtgtgcgagcatgatcatggtcagactaccggcttgtttggggatttcaagtaatgatgatgctttgaagttaaggacacatctacgggagcaatttggtgttgaagtcccaatatattaccagatgccgaaacatgaagaggtttcaacaacaacaggctatgctcgaatttcttatcaagtctacaacaaaatagatgactattataagttcagagatgcaattaatcaacttgtttgtgatggtttcacctgtgctcaatctttaggtaaatatggtctgccttcatcctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00270 map00270

Pfam Domains

Protein Families

Aminotran_5

Protein Analysis

271

Amino Acids

30.25

Weight (kDa)

7.12

Isoelectric Point (pI)

40.64

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002899)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G62130 AT3G62130
fragaria_vesca	FvH4_4g04240 FvH4_6g08442 FvH4_6g08442 FvH4_6g08590 FvH4_6g34050 FvH4_7g09780
malus_domestica	MD12G1200200.v1.1
prunus_persica	Prupe.6G305000_v2.0.a1 Prupe.6G305100_v2.0.a1 Prupe.6G305200_v2.0.a1 Prupe.6G305300_v2.0.a1 Prupe.6G305300_v2.0.a1
pyrus_communis	pycom12g18680
rosa_chinensis	RchiOBHm_Chr2g0123491 RchiOBHm_Chr2g0123501 RchiOBHm_Chr2g0123511 RchiOBHm_Chr3g0458441
rosa_laevigata	RLG00000015569 RLG00000015570 RLG00000025157
rosa_multiflora	Rmu_sc0013809.1_g000004 Rmu_sc0017098.1_g000006 Rmu_sc0017098.1_g000007 Rmu_ssc0000091.1_g000003
rosa_rugosa	Rorug03G0028400 Rorug03G0028700
rosa_samantha	Rh2AG304800 Rh2BG312900 Rh2BG313000 Rh2CG291300 Rh2DG328800 Rh3BG090600 Rh3DG091400
rosa_wichuraiana	Rw0G018550 Rw2G024430 Rw3G007450

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	729
AccI	GTMKAC	1 cut(s)	705
AciI	CCGC	1 cut(s)	420
AcsI	RAATTY	1 cut(s)	690
AcuI	CTGAAG	1 cut(s)	372
AfaI	GTAC	1 cut(s)	84
AfiI	CCNNNNNNNGG	2 cut(s)	244, 504
AgsI	TTSAA	6 cut(s)	338, 416, 570, 589, 626, 669
AhlI	ACTAGT	1 cut(s)	209
AluBI	AGCT	1 cut(s)	47
AluI	AGCT	1 cut(s)	47
Alw21I	GWGCWC	1 cut(s)	781
Alw26I	GTCTC	2 cut(s)	312, 513
ApoI	RAATTY	1 cut(s)	690
AseI	ATTAAT	1 cut(s)	747
AsuHPI	GGTGA	2 cut(s)	22, 763
BanII	GRGCYC	1 cut(s)	154
Bbv12I	GWGCWC	1 cut(s)	781
BccI	CCATC	5 cut(s)	82, 140, 379, 460, 758
BclI	TGATCA	3 cut(s)	55, 130, 534
BcoDI	GTCTC	2 cut(s)	312, 513
BcuI	ACTAGT	1 cut(s)	209
BfaI	CTAG	3 cut(s)	24, 210, 357
BmiI	GGNNCC	2 cut(s)	384, 496
BmsI	GCATC	5 cut(s)	301, 442, 571, 636, 730
BsaI	GGTCTC	1 cut(s)	513
Bsc4I	CCNNNNNNNGG	2 cut(s)	244, 504
Bse118I	RCCGGY	1 cut(s)	550
Bse1I	ACTGG	1 cut(s)	89
BseGI	GGATG	3 cut(s)	65, 295, 809
BseLI	CCNNNNNNNGG	2 cut(s)	244, 504
BseNI	ACTGG	1 cut(s)	89
BsiHKAI	GWGCWC	1 cut(s)	781
BsiSI	CCGG	1 cut(s)	551
BslFI	GGGAC	1 cut(s)	614
BslI	CCNNNNNNNGG	2 cut(s)	244, 504
BsmAI	GTCTC	2 cut(s)	312, 513
BsmFI	GGGAC	1 cut(s)	614
Bso31I	GGTCTC	1 cut(s)	513
Bsp1286I	GDGCHC	2 cut(s)	154, 781
Bsp143I	GATC	3 cut(s)	55, 130, 534
BspACI	CCGC	1 cut(s)	420
BspHI	TCATGA	2 cut(s)	310, 448
BspLI	GGNNCC	2 cut(s)	384, 496
BspTNI	GGTCTC	1 cut(s)	513
BsrFI	RCCGGY	1 cut(s)	550
BsrI	ACTGG	1 cut(s)	89
BssAI	RCCGGY	1 cut(s)	550
BssMI	GATC	3 cut(s)	55, 130, 534
Bst6I	CTCTTC	2 cut(s)	28, 654
BstC8I	GCNNGC	1 cut(s)	529
BstF5I	GGATG	3 cut(s)	65, 295, 809
BstKTI	GATC	3 cut(s)	58, 133, 537
BstMAI	GTCTC	2 cut(s)	312, 513
BstMBI	GATC	3 cut(s)	55, 130, 534
BstMWI	GCNNNNNNNGC	1 cut(s)	248
BstNSI	RCATGY	1 cut(s)	184
BtsCI	GGATG	3 cut(s)	65, 295, 809
Cac8I	GCNNGC	1 cut(s)	529
CciI	TCATGA	2 cut(s)	310, 448
Cfr10I	RCCGGY	1 cut(s)	550
Csp6I	GTAC	1 cut(s)	83
CviAII	CATG	9 cut(s)	59, 70, 155, 181, 311, 449, 532, 538, 656
CviJI	RGCY	8 cut(s)	5, 23, 47, 152, 332, 488, 554, 681
CviKI_1	RGCY	8 cut(s)	5, 23, 47, 152, 332, 488, 554, 681
CviQI	GTAC	1 cut(s)	83
DpnI	GATC	3 cut(s)	57, 132, 536
DpnII	GATC	3 cut(s)	55, 130, 534
Eam1104I	CTCTTC	2 cut(s)	28, 654
EarI	CTCTTC	2 cut(s)	28, 654
Eco24I	GRGCYC	1 cut(s)	154
Eco31I	GGTCTC	1 cut(s)	513
Eco57I	CTGAAG	1 cut(s)	372
EcoT38I	GRGCYC	1 cut(s)	154
FaeI	CATG	9 cut(s)	62, 73, 158, 184, 314, 452, 535, 541, 659
FalI	AAGNNNNNCTT	2 cut(s)	215, 247
FaqI	GGGAC	1 cut(s)	614
FatI	CATG	9 cut(s)	58, 69, 154, 180, 310, 448, 531, 537, 655
FbaI	TGATCA	3 cut(s)	55, 130, 534
FblI	GTMKAC	1 cut(s)	705
FokI	GGATG	3 cut(s)	52, 282, 796
FriOI	GRGCYC	1 cut(s)	154
FspBI	CTAG	3 cut(s)	24, 210, 357
HapII	CCGG	1 cut(s)	551
Hin1II	CATG	9 cut(s)	62, 73, 158, 184, 314, 452, 535, 541, 659
HincII	GTYRAC	1 cut(s)	178
HindII	GTYRAC	1 cut(s)	178
HinfI	GANTC	2 cut(s)	432, 445
HpaII	CCGG	1 cut(s)	551
HphI	GGTGA	2 cut(s)	22, 763
Hpy166II	GTNNAC	3 cut(s)	178, 402, 706
Hpy188I	TCNGA	2 cut(s)	545, 737
Hpy188III	TCNNGA	2 cut(s)	311, 449
Hpy8I	GTNNAC	3 cut(s)	178, 402, 706
HpyAV	CCTTC	5 cut(s)	7, 116, 396, 410, 816
HpyCH4V	TGCA	6 cut(s)	114, 184, 220, 251, 292, 743
HpyF10VI	GCNNNNNNNGC	1 cut(s)	248
Hsp92II	CATG	9 cut(s)	62, 73, 158, 184, 314, 452, 535, 541, 659
Ksp22I	TGATCA	3 cut(s)	55, 130, 534
Kzo9I	GATC	3 cut(s)	55, 130, 534
LmnI	GCTCC	2 cut(s)	194, 610
LpnPI	CCDG	8 cut(s)	100, 102, 252, 528, 564, 656, 663, 787
LweI	GCATC	5 cut(s)	301, 442, 571, 636, 730
MaeI	CTAG	3 cut(s)	24, 210, 357
MaeIII	GTNAC	2 cut(s)	61, 274
MalI	GATC	3 cut(s)	57, 132, 536
MboI	GATC	3 cut(s)	55, 130, 534
MboII	GAAGA	4 cut(s)	45, 131, 223, 671
MhlI	GDGCHC	2 cut(s)	154, 781
MluCI	AATT	7 cut(s)	98, 189, 214, 287, 614, 690, 744
MmeI	TCCRAC	1 cut(s)	326
MnlI	CCTC	3 cut(s)	421, 435, 655
MseI	TTAA	4 cut(s)	93, 105, 593, 747
MslI	CAYNNNNRTG	2 cut(s)	315, 536
MspI	CCGG	1 cut(s)	551
MwoI	GCNNNNNNNGC	1 cut(s)	248
NdeII	GATC	3 cut(s)	55, 130, 534
NlaIII	CATG	9 cut(s)	62, 73, 158, 184, 314, 452, 535, 541, 659
NlaIV	GGNNCC	2 cut(s)	384, 496
NmuCI	GTSAC	1 cut(s)	274
NspI	RCATGY	1 cut(s)	184
PagI	TCATGA	2 cut(s)	310, 448
PfeI	GAWTC	2 cut(s)	432, 445
PshBI	ATTAAT	1 cut(s)	747
PsiI	TTATAA	1 cut(s)	729
PspN4I	GGNNCC	2 cut(s)	384, 496
RsaI	GTAC	1 cut(s)	84
RsaNI	GTAC	1 cut(s)	83
RseI	CAYNNNNRTG	2 cut(s)	315, 536
SaqAI	TTAA	4 cut(s)	93, 105, 593, 747
Sau3AI	GATC	3 cut(s)	55, 130, 534
SduI	GDGCHC	2 cut(s)	154, 781
SetI	ASST	6 cut(s)	49, 127, 413, 666, 776, 793
SfaNI	GCATC	5 cut(s)	301, 442, 571, 636, 730
SmiMI	CAYNNNNRTG	2 cut(s)	315, 536
SpeI	ACTAGT	1 cut(s)	209
Sse9I	AATT	7 cut(s)	98, 189, 214, 287, 614, 690, 744
SsiI	CCGC	1 cut(s)	420
SspMI	CTAG	3 cut(s)	24, 210, 357
TaqI	TCGA	1 cut(s)	688
TasI	AATT	7 cut(s)	98, 189, 214, 287, 614, 690, 744
TatI	WGTACW	1 cut(s)	82
TfiI	GAWTC	2 cut(s)	432, 445
Tru1I	TTAA	4 cut(s)	93, 105, 593, 747
Tru9I	TTAA	4 cut(s)	93, 105, 593, 747
TseFI	GTSAC	1 cut(s)	274
Tsp45I	GTSAC	1 cut(s)	274
TspDTI	ATGAA	3 cut(s)	130, 672, 798
VspI	ATTAAT	1 cut(s)	747
XapI	RAATTY	1 cut(s)	690
XceI	RCATGY	1 cut(s)	184
XmiI	GTMKAC	1 cut(s)	705
XspI	CTAG	3 cut(s)	24, 210, 357

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.