Rmu_sc0017098.1_g000006

Aminotransferase class-V

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0017098.1
Physical Location & Seq
Reverse (-)
19821 .. 20309
489 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0017098.1_g000006.1.cds

Sequence Viewer

Length: 489 bp
atgccatatgttgtacttccagataaggaattggttaaagtttgcagggaagaaggtgttgatctagttttcatagatggggctcatggtgttgggtgtgtagatgttgacatgcaagaaattggagcagatttttacactagtaatctgcacaagtggttcttctcccctgcttcggttgcatttttatattgtaggaagtcagtcacacatttagaattgcatcatcctatggtgtctcatgactatggtaaagggttggctattgaaagtagttggatagggactagggattatagtccatctttagtgattccttcagttgtggagttcacaaataggtttgaaggcggtattaagggaatcaaaacgaggaatcatgatgctgttgttgagataggcttggggaaccaatcttgggtctccgccagatatgtgtgcaagcatgatcgtggtgggaataccggcttgtttggaggtttcaagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

162

Amino Acids

17.96

Weight (kDa)

6.22

Isoelectric Point (pI)

20.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 351, 426
AcuI CTGAAG 1 cut(s) 303
AfaI GTAC 1 cut(s) 15
AfiI CCNNNNNNNGG 2 cut(s) 175, 418
AgsI TTSAA 3 cut(s) 269, 347, 484
AhlI ACTAGT 1 cut(s) 140
Alw26I GTCTC 2 cut(s) 243, 427
BanII GRGCYC 1 cut(s) 85
BccI CCATC 2 cut(s) 71, 310
BcoDI GTCTC 2 cut(s) 243, 427
BcuI ACTAGT 1 cut(s) 140
BfaI CTAG 3 cut(s) 65, 141, 288
BmiI GGNNCC 1 cut(s) 410
BmsI GCATC 2 cut(s) 232, 373
BsaI GGTCTC 1 cut(s) 427
Bsc4I CCNNNNNNNGG 2 cut(s) 175, 418
Bse118I RCCGGY 1 cut(s) 464
BseGI GGATG 1 cut(s) 226
BseLI CCNNNNNNNGG 2 cut(s) 175, 418
BsgI GTGCAG 1 cut(s) 134
BsiSI CCGG 1 cut(s) 465
BslFI GGGAC 1 cut(s) 298
BslI CCNNNNNNNGG 2 cut(s) 175, 418
BsmAI GTCTC 2 cut(s) 243, 427
BsmFI GGGAC 1 cut(s) 298
Bso31I GGTCTC 1 cut(s) 427
Bsp1286I GDGCHC 1 cut(s) 85
Bsp143I GATC 2 cut(s) 61, 448
BspACI CCGC 2 cut(s) 351, 426
BspHI TCATGA 2 cut(s) 241, 379
BspLI GGNNCC 1 cut(s) 410
BspTNI GGTCTC 1 cut(s) 427
BsrFI RCCGGY 1 cut(s) 464
BssAI RCCGGY 1 cut(s) 464
BssMI GATC 2 cut(s) 61, 448
BstC8I GCNNGC 1 cut(s) 443
BstF5I GGATG 1 cut(s) 226
BstKTI GATC 2 cut(s) 64, 451
BstMAI GTCTC 2 cut(s) 243, 427
BstMBI GATC 2 cut(s) 61, 448
BstMWI GCNNNNNNNGC 1 cut(s) 179
BstNSI RCATGY 1 cut(s) 115
BtsCI GGATG 1 cut(s) 226
Cac8I GCNNGC 1 cut(s) 443
CciI TCATGA 2 cut(s) 241, 379
Cfr10I RCCGGY 1 cut(s) 464
Csp6I GTAC 1 cut(s) 14
CviAII CATG 5 cut(s) 86, 112, 242, 380, 446
CviJI RGCY 4 cut(s) 83, 263, 402, 468
CviKI_1 RGCY 4 cut(s) 83, 263, 402, 468
CviQI GTAC 1 cut(s) 14
DpnI GATC 2 cut(s) 63, 450
DpnII GATC 2 cut(s) 61, 448
EciI GGCGGA 1 cut(s) 415
Eco24I GRGCYC 1 cut(s) 85
Eco31I GGTCTC 1 cut(s) 427
Eco57I CTGAAG 1 cut(s) 303
EcoT38I GRGCYC 1 cut(s) 85
FaeI CATG 5 cut(s) 89, 115, 245, 383, 449
FalI AAGNNNNNCTT 2 cut(s) 146, 178
FaqI GGGAC 1 cut(s) 298
FatI CATG 5 cut(s) 85, 111, 241, 379, 445
FauNDI CATATG 1 cut(s) 7
FokI GGATG 1 cut(s) 213
FriOI GRGCYC 1 cut(s) 85
FspBI CTAG 3 cut(s) 65, 141, 288
HapII CCGG 1 cut(s) 465
Hin1II CATG 5 cut(s) 89, 115, 245, 383, 449
HincII GTYRAC 1 cut(s) 109
HindII GTYRAC 1 cut(s) 109
HinfI GANTC 3 cut(s) 313, 363, 376
HpaII CCGG 1 cut(s) 465
Hpy166II GTNNAC 2 cut(s) 109, 333
Hpy188III TCNNGA 3 cut(s) 20, 242, 380
Hpy8I GTNNAC 2 cut(s) 109, 333
HpyAV CCTTC 3 cut(s) 47, 327, 341
HpyCH4V TGCA 6 cut(s) 45, 115, 151, 182, 223, 441
HpyF10VI GCNNNNNNNGC 1 cut(s) 179
Hsp92II CATG 5 cut(s) 89, 115, 245, 383, 449
Kzo9I GATC 2 cut(s) 61, 448
LmnI GCTCC 1 cut(s) 125
LpnPI CCDG 5 cut(s) 31, 33, 183, 442, 478
LweI GCATC 2 cut(s) 232, 373
MaeI CTAG 3 cut(s) 65, 141, 288
MaeIII GTNAC 1 cut(s) 205
MalI GATC 2 cut(s) 63, 450
MboI GATC 2 cut(s) 61, 448
MboII GAAGA 2 cut(s) 62, 154
MhlI GDGCHC 1 cut(s) 85
MluCI AATT 3 cut(s) 29, 120, 218
MmeI TCCRAC 1 cut(s) 257
MnlI CCTC 2 cut(s) 366, 470
MseI TTAA 2 cut(s) 36, 357
MslI CAYNNNNRTG 2 cut(s) 246, 450
MspI CCGG 1 cut(s) 465
MwoI GCNNNNNNNGC 1 cut(s) 179
NdeI CATATG 1 cut(s) 7
NdeII GATC 2 cut(s) 61, 448
NlaIII CATG 5 cut(s) 89, 115, 245, 383, 449
NlaIV GGNNCC 1 cut(s) 410
NmuCI GTSAC 1 cut(s) 205
NspI RCATGY 1 cut(s) 115
PagI TCATGA 2 cut(s) 241, 379
PfeI GAWTC 3 cut(s) 313, 363, 376
PspN4I GGNNCC 1 cut(s) 410
RsaI GTAC 1 cut(s) 15
RsaNI GTAC 1 cut(s) 14
RseI CAYNNNNRTG 2 cut(s) 246, 450
SaqAI TTAA 2 cut(s) 36, 357
Sau3AI GATC 2 cut(s) 61, 448
SduI GDGCHC 1 cut(s) 85
SetI ASST 3 cut(s) 58, 344, 481
SfaNI GCATC 2 cut(s) 232, 373
SmiMI CAYNNNNRTG 2 cut(s) 246, 450
SpeI ACTAGT 1 cut(s) 140
Sse9I AATT 3 cut(s) 29, 120, 218
SsiI CCGC 2 cut(s) 351, 426
SspMI CTAG 3 cut(s) 65, 141, 288
TasI AATT 3 cut(s) 29, 120, 218
TatI WGTACW 1 cut(s) 13
TfiI GAWTC 3 cut(s) 313, 363, 376
Tru1I TTAA 2 cut(s) 36, 357
Tru9I TTAA 2 cut(s) 36, 357
TseFI GTSAC 1 cut(s) 205
Tsp45I GTSAC 1 cut(s) 205
TspDTI ATGAA 1 cut(s) 61
XceI RCATGY 1 cut(s) 115
XspI CTAG 3 cut(s) 65, 141, 288
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.