RLG00000030476

Ankyrin repeats (many copies)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
OG0002248
Physical Location & Seq
Forward (+)
62206586 .. 62207465
880 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000030476

Sequence Viewer

Length: 399 bp
ATGTGCAAGTACTTGCTGGAGGAATTGAAAATTGATGTTGATACCAAAGATGAAGATGGCGACACTCCCCTTATTCATGCTGCTCACCTAGGCCATACTGATACTGCCAAACTGCTTCTTGAGTATGGTGCCAATTCGTCTATAGCCAGTGATTTAGGGGCTACAGCTCTTCATCATTCCGCTGGACTAGGAAACATTGAGTTGCTGAGGTACTTAATTTCCAAGTGTGTTGATGTCAATTCACAAAGTGATGCTGGTTCTCCTTTAATTTGGGCTGCTGGTCATGACCAACTAGATGCTGTGAAAGTTCTGTTAGAACACCAGGCTAATAATAGAGCCATGAGTTTGCTTGGTGTTCTGTACAGGGAGTACCTATCTTGTGGGTATCTCTACTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ank_2 Ank_3 Ank_4 Ank_5 DUF1685 TPR_17 TPR_8

Protein Analysis

133

Amino Acids

14.4

Weight (kDa)

5.0

Isoelectric Point (pI)

21.23

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ank_2 PF12796 1 - 45 2.5e-08 Ankyrin repeats (3 copies)
Ank_4 PF13637 1 - 40 1.3e-06 Ankyrin repeats (many copies)
Ank PF00023 19 - 47 3.4e-07 Ankyrin repeat
Ank_4 PF13637 24 - 73 1.1e-07 Ankyrin repeats (many copies)
Ank_2 PF12796 49 - 111 1.6e-11 Ankyrin repeats (3 copies)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 128
AciI CCGC 1 cut(s) 180
AdeI CACNNNGTG 1 cut(s) 248
AfaI GTAC 4 cut(s) 11, 212, 362, 371
AgsI TTSAA 1 cut(s) 28
AjnI CCWGG 1 cut(s) 321
AluBI AGCT 1 cut(s) 167
AluI AGCT 1 cut(s) 167
AoxI GGCC 1 cut(s) 91
ApeKI GCWGC 2 cut(s) 80, 275
AspA2I CCTAGG 1 cut(s) 88
AsuHPI GGTGA 1 cut(s) 77
AvrII CCTAGG 1 cut(s) 88
BanI GGYRCC 1 cut(s) 128
BbvCI CCTCAGC 1 cut(s) 206
BbvI GCAGC 2 cut(s) 67, 262
BccI CCATC 1 cut(s) 50
BciT130I CCWGG 1 cut(s) 323
BfaI CTAG 3 cut(s) 89, 188, 293
BfmI CTRYAG 2 cut(s) 141, 162
BisI GCNGC 2 cut(s) 81, 276
BlnI CCTAGG 1 cut(s) 88
BlsI GCNGC 2 cut(s) 82, 277
BmcAI AGTACT 1 cut(s) 11
Bme1390I CCNGG 1 cut(s) 323
BmiI GGNNCC 1 cut(s) 130
BmrFI CCNGG 1 cut(s) 323
BmsI GCATC 2 cut(s) 241, 286
BpmI CTGGAG 1 cut(s) 38
Bpu10I CCTNAGC 1 cut(s) 206
BpuEI CTTGAG 1 cut(s) 140
BsaJI CCNNGG 1 cut(s) 88
Bse1I ACTGG 1 cut(s) 147
BseBI CCWGG 1 cut(s) 323
BseDI CCNNGG 1 cut(s) 88
BseMII CTCAG 1 cut(s) 197
BseNI ACTGG 1 cut(s) 147
BseXI GCAGC 2 cut(s) 67, 262
BshFI GGCC 1 cut(s) 93
BshNI GGYRCC 1 cut(s) 128
BsnI GGCC 1 cut(s) 93
Bsp1407I TGTACA 1 cut(s) 360
BspACI CCGC 1 cut(s) 180
BspANI GGCC 1 cut(s) 93
BspCNI CTCAG 1 cut(s) 198
BspHI TCATGA 1 cut(s) 283
BspLI GGNNCC 1 cut(s) 130
BspQI GCTCTTC 1 cut(s) 174
BspT107I GGYRCC 1 cut(s) 128
BsrGI TGTACA 1 cut(s) 360
BsrI ACTGG 1 cut(s) 147
BssECI CCNNGG 1 cut(s) 88
BssT1I CCWWGG 1 cut(s) 88
Bst2UI CCWGG 1 cut(s) 323
Bst6I CTCTTC 1 cut(s) 174
BstAUI TGTACA 1 cut(s) 360
BstDEI CTNAG 1 cut(s) 206
BstNI CCWGG 1 cut(s) 323
BstSCI CCNGG 1 cut(s) 321
BstSFI CTRYAG 2 cut(s) 141, 162
BstV1I GCAGC 2 cut(s) 67, 262
BsuRI GGCC 1 cut(s) 93
BtsIMutI CAGTG 1 cut(s) 154
CciI TCATGA 1 cut(s) 283
Csp6I GTAC 4 cut(s) 10, 211, 361, 370
CviAII CATG 3 cut(s) 77, 284, 340
CviJI RGCY 7 cut(s) 93, 146, 161, 167, 275, 326, 338
CviKI_1 RGCY 7 cut(s) 93, 146, 161, 167, 275, 326, 338
CviQI GTAC 4 cut(s) 10, 211, 361, 370
DdeI CTNAG 1 cut(s) 206
DraIII CACNNNGTG 1 cut(s) 248
Eam1104I CTCTTC 1 cut(s) 174
EarI CTCTTC 1 cut(s) 174
Eco130I CCWWGG 1 cut(s) 88
EcoRII CCWGG 1 cut(s) 321
EcoT14I CCWWGG 1 cut(s) 88
ErhI CCWWGG 1 cut(s) 88
FaeI CATG 3 cut(s) 80, 287, 343
FaiI YATR 6 cut(s) 78, 96, 126, 143, 285, 341
FatI CATG 3 cut(s) 76, 283, 339
Fnu4HI GCNGC 2 cut(s) 81, 276
Fsp4HI GCNGC 2 cut(s) 81, 276
FspBI CTAG 3 cut(s) 89, 188, 293
GluI GCNGC 2 cut(s) 81, 276
GsuI CTGGAG 1 cut(s) 38
HaeIII GGCC 1 cut(s) 93
Hin1II CATG 3 cut(s) 80, 287, 343
HphI GGTGA 1 cut(s) 77
Hpy188III TCNNGA 2 cut(s) 119, 284
HpyCH4V TGCA 1 cut(s) 6
HpyF3I CTNAG 1 cut(s) 206
Hsp92II CATG 3 cut(s) 80, 287, 343
LguI GCTCTTC 1 cut(s) 174
LpnPI CCDG 8 cut(s) 2, 160, 168, 240, 264, 308, 335, 349
Lsp1109I GCAGC 2 cut(s) 67, 262
LweI GCATC 2 cut(s) 241, 286
MaeI CTAG 3 cut(s) 89, 188, 293
MboII GAAGA 2 cut(s) 65, 161
MluCI AATT 6 cut(s) 23, 30, 133, 216, 238, 267
MnlI CCTC 2 cut(s) 13, 201
MseI TTAA 2 cut(s) 215, 266
MspA1I CMGCKG 1 cut(s) 182
MspR9I CCNGG 1 cut(s) 323
MvaI CCWGG 1 cut(s) 323
NlaIII CATG 3 cut(s) 80, 287, 343
NlaIV GGNNCC 1 cut(s) 130
PagI TCATGA 1 cut(s) 283
PciSI GCTCTTC 1 cut(s) 174
PkrI GCNGC 2 cut(s) 82, 277
Psp6I CCWGG 1 cut(s) 321
PspGI CCWGG 1 cut(s) 321
PspN4I GGNNCC 1 cut(s) 130
RsaI GTAC 4 cut(s) 11, 212, 362, 371
RsaNI GTAC 4 cut(s) 10, 211, 361, 370
SapI GCTCTTC 1 cut(s) 174
SaqAI TTAA 2 cut(s) 215, 266
SatI GCNGC 2 cut(s) 81, 276
ScaI AGTACT 1 cut(s) 11
ScrFI CCNGG 1 cut(s) 323
SetI ASST 4 cut(s) 90, 169, 212, 375
SfaNI GCATC 2 cut(s) 241, 286
SfcI CTRYAG 2 cut(s) 141, 162
SmlI CTYRAG 1 cut(s) 119
SmoI CTYRAG 1 cut(s) 119
Sse9I AATT 6 cut(s) 23, 30, 133, 216, 238, 267
SsiI CCGC 1 cut(s) 180
SspMI CTAG 3 cut(s) 89, 188, 293
StyD4I CCNGG 1 cut(s) 321
StyI CCWWGG 1 cut(s) 88
TasI AATT 6 cut(s) 23, 30, 133, 216, 238, 267
TatI WGTACW 2 cut(s) 9, 360
Tru1I TTAA 2 cut(s) 215, 266
Tru9I TTAA 2 cut(s) 215, 266
TscAI CASTG 1 cut(s) 154
TseI GCWGC 2 cut(s) 80, 275
TspDTI ATGAA 3 cut(s) 65, 66, 161
TspRI CASTG 1 cut(s) 154
XmaJI CCTAGG 1 cut(s) 88
XspI CTAG 3 cut(s) 89, 188, 293
ZrmI AGTACT 1 cut(s) 11
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.