RLG00000033634

B3 DNA binding domain

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
Physical Location & Seq
Reverse (-)
29795084 .. 29805725
10642 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000033634

Sequence Viewer

Length: 525 bp
ATGGAAACGGAAGGCTGGAGAGACTGTGCTGTTTGTGGGAAGCCACTCCATTGTGGATGCATTATGTCACGCCACAAGTATGCACCACTGGATTTCGGAGGTGTAGGTTGCACAAAATGCTTACTAGAAGTTGATCAATCTATTGCTTCAGGTCGAATGACCAGAATGCTGAAAGAAATAGGCACAATCTCCGATGGTAATGGAAACAAGTCCATTAGTCCAATGCCTATAGAAACAAATCAGAAAACGAACCAGGAACAATCTCTAAGGGACTTTGAAACAGGTCCAACACCTGTAGATACAAGTCTGAAAACAGACCAGGGACAATCTCCAAAGGATATGGAAACAGGTCCAACGCCTGTAGAAACAAGTCTGAAAACAAACCAGGAAGTCTCCCAAGGGATATGGAAACAAGTCCGAAAACAGACTAGTGATGTTCTGAAACTAGTTATTATCCTCCAGGACTGTGAACCCTGTGCTATCCCTGGATGGGTGAAGGCCTTTTATGCAGTTAGAGTTTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

175

Amino Acids

19.11

Weight (kDa)

6.13

Isoelectric Point (pI)

46.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf_VAL1_N PF25813 2 - 42 2.1e-19 VAL1-like, N-terminal zinc finger domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 132
AfiI CCNNNNNNNGG 1 cut(s) 490
AgsI TTSAA 1 cut(s) 278
AhlI ACTAGT 2 cut(s) 428, 445
AjnI CCWGG 5 cut(s) 252, 318, 384, 459, 484
Alw26I GTCTC 2 cut(s) 15, 397
AoxI GGCC 1 cut(s) 498
AspS9I GGNCC 2 cut(s) 284, 350
AsuHPI GGTGA 1 cut(s) 505
AvaII GGWCC 2 cut(s) 284, 350
BccI CCATC 2 cut(s) 188, 483
BciT130I CCWGG 5 cut(s) 254, 320, 386, 461, 486
BclI TGATCA 1 cut(s) 133
BcoDI GTCTC 2 cut(s) 15, 397
BcuI ACTAGT 2 cut(s) 428, 445
BfaI CTAG 3 cut(s) 125, 429, 446
BfmI CTRYAG 3 cut(s) 228, 294, 360
Bme1390I CCNGG 5 cut(s) 254, 320, 386, 461, 486
Bme18I GGWCC 2 cut(s) 284, 350
BmgT120I GGNCC 2 cut(s) 284, 350
BmrFI CCNGG 5 cut(s) 254, 320, 386, 461, 486
BmsI GCATC 1 cut(s) 47
BpmI CTGGAG 2 cut(s) 37, 443
BsaJI CCNNGG 3 cut(s) 319, 397, 484
BsaXI ACNNNNNCTCC 2 cut(s) 10, 40
Bsc4I CCNNNNNNNGG 1 cut(s) 490
Bse1I ACTGG 1 cut(s) 93
BseBI CCWGG 5 cut(s) 254, 320, 386, 461, 486
BseDI CCNNGG 3 cut(s) 319, 397, 484
BseGI GGATG 2 cut(s) 62, 494
BseLI CCNNNNNNNGG 1 cut(s) 490
BseNI ACTGG 1 cut(s) 93
BshFI GGCC 1 cut(s) 500
BslFI GGGAC 2 cut(s) 284, 336
BslI CCNNNNNNNGG 1 cut(s) 490
BsmAI GTCTC 2 cut(s) 15, 397
BsmFI GGGAC 2 cut(s) 284, 336
BsmI GAATGC 1 cut(s) 171
BsnI GGCC 1 cut(s) 500
Bsp143I GATC 1 cut(s) 133
BspANI GGCC 1 cut(s) 500
BsrI ACTGG 1 cut(s) 93
BssECI CCNNGG 3 cut(s) 319, 397, 484
BssMI GATC 1 cut(s) 133
BssT1I CCWWGG 1 cut(s) 397
Bst2UI CCWGG 5 cut(s) 254, 320, 386, 461, 486
Bst4CI ACNGT 2 cut(s) 26, 467
BstAPI GCANNNNNTGC 1 cut(s) 117
BstDEI CTNAG 1 cut(s) 266
BstF5I GGATG 2 cut(s) 62, 494
BstKTI GATC 1 cut(s) 136
BstMAI GTCTC 2 cut(s) 15, 397
BstMBI GATC 1 cut(s) 133
BstMWI GCNNNNNNNGC 2 cut(s) 117, 506
BstNI CCWGG 5 cut(s) 254, 320, 386, 461, 486
BstSCI CCNGG 5 cut(s) 252, 318, 384, 459, 484
BstSFI CTRYAG 3 cut(s) 228, 294, 360
BsuRI GGCC 1 cut(s) 500
BtsCI GGATG 2 cut(s) 62, 494
BtsIMutI CAGTG 1 cut(s) 86
Cfr13I GGNCC 2 cut(s) 284, 350
CviJI RGCY 3 cut(s) 15, 43, 500
CviKI_1 RGCY 3 cut(s) 15, 43, 500
DdeI CTNAG 1 cut(s) 266
DpnI GATC 1 cut(s) 135
DpnII GATC 1 cut(s) 133
Eco130I CCWWGG 1 cut(s) 397
Eco147I AGGCCT 1 cut(s) 500
Eco47I GGWCC 2 cut(s) 284, 350
Eco57I CTGAAG 1 cut(s) 132
EcoRII CCWGG 5 cut(s) 252, 318, 384, 459, 484
EcoT14I CCWWGG 1 cut(s) 397
EcoT22I ATGCAT 1 cut(s) 62
ErhI CCWWGG 1 cut(s) 397
FaiI YATR 7 cut(s) 65, 81, 230, 341, 406, 507, 523
FaqI GGGAC 2 cut(s) 284, 336
FbaI TGATCA 1 cut(s) 133
FokI GGATG 2 cut(s) 69, 501
FspBI CTAG 3 cut(s) 125, 429, 446
GsuI CTGGAG 2 cut(s) 37, 443
HaeIII GGCC 1 cut(s) 500
HphI GGTGA 1 cut(s) 505
Hpy166II GTNNAC 1 cut(s) 470
Hpy188I TCNGA 7 cut(s) 98, 193, 243, 309, 375, 419, 441
Hpy8I GTNNAC 1 cut(s) 470
HpyAV CCTTC 2 cut(s) 5, 490
HpyCH4III ACNGT 2 cut(s) 26, 467
HpyCH4V TGCA 4 cut(s) 60, 83, 111, 509
HpyF10VI GCNNNNNNNGC 2 cut(s) 117, 506
HpyF3I CTNAG 1 cut(s) 266
Ksp22I TGATCA 1 cut(s) 133
Kzo9I GATC 1 cut(s) 133
LweI GCATC 1 cut(s) 47
MaeI CTAG 3 cut(s) 125, 429, 446
MaeIII GTNAC 1 cut(s) 66
MalI GATC 1 cut(s) 135
MboI GATC 1 cut(s) 133
MmeI TCCRAC 2 cut(s) 311, 377
MnlI CCTC 2 cut(s) 92, 467
Mph1103I ATGCAT 1 cut(s) 62
MslI CAYNNNNRTG 1 cut(s) 78
MspR9I CCNGG 5 cut(s) 254, 320, 386, 461, 486
Mva1269I GAATGC 1 cut(s) 171
MvaI CCWGG 5 cut(s) 254, 320, 386, 461, 486
MwoI GCNNNNNNNGC 2 cut(s) 117, 506
NdeII GATC 1 cut(s) 133
NmuCI GTSAC 1 cut(s) 66
NsiI ATGCAT 1 cut(s) 62
PceI AGGCCT 1 cut(s) 500
PctI GAATGC 1 cut(s) 171
PfoI TCCNGGA 1 cut(s) 459
Psp6I CCWGG 5 cut(s) 252, 318, 384, 459, 484
PspGI CCWGG 5 cut(s) 252, 318, 384, 459, 484
PspPI GGNCC 2 cut(s) 284, 350
RseI CAYNNNNRTG 1 cut(s) 78
Sau3AI GATC 1 cut(s) 133
Sau96I GGNCC 2 cut(s) 284, 350
ScrFI CCNGG 5 cut(s) 254, 320, 386, 461, 486
SetI ASST 6 cut(s) 103, 109, 154, 286, 295, 352
SfaNI GCATC 1 cut(s) 47
SfcI CTRYAG 3 cut(s) 228, 294, 360
SinI GGWCC 2 cut(s) 284, 350
SmiMI CAYNNNNRTG 1 cut(s) 78
SpeI ACTAGT 2 cut(s) 428, 445
SseBI AGGCCT 1 cut(s) 500
SspMI CTAG 3 cut(s) 125, 429, 446
StuI AGGCCT 1 cut(s) 500
StyD4I CCNGG 5 cut(s) 252, 318, 384, 459, 484
StyI CCWWGG 1 cut(s) 397
TaaI ACNGT 2 cut(s) 26, 467
TaqI TCGA 1 cut(s) 154
TscAI CASTG 1 cut(s) 93
TseFI GTSAC 1 cut(s) 66
Tsp45I GTSAC 1 cut(s) 66
TspDTI ATGAA 1 cut(s) 510
TspGWI ACGGA 1 cut(s) 23
TspRI CASTG 1 cut(s) 93
VpaK11BI GGWCC 2 cut(s) 284, 350
XspI CTAG 3 cut(s) 125, 429, 446
Zsp2I ATGCAT 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.