Rh5AG245200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0001196
Physical Location & Seq
Reverse (-)
30220597 .. 30220827
231 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG245200.1

Sequence Viewer

Length: 231 bp
ATGGACCCAACAGTTTCATCTGATCTTACTAAGAAAGTTGTCGAGTCCCTTTTTCCTGAATCTTTACAAGCTCCAGCACCTCAGATTGGAGAAGAATCCAATACGGATGTATCTAATGGAGATACTGGTGAACCTAAATTGGAACTGACTCTAAATTCAGACCTAGAGACGAAATTCCATACCAGTTCAGCAACCCCAAAACCACATGCGACTCCGAAGGCAAACCGGAAC
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.25

Weight (kDa)

4.77

Isoelectric Point (pI)

37.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 154, 173
AfiI CCNNNNNNNGG 1 cut(s) 86
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
Alw26I GTCTC 1 cut(s) 161
ApoI RAATTY 2 cut(s) 154, 173
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 1 cut(s) 140
AvaII GGWCC 1 cut(s) 4
BaeI ACNNNNGTAYC 2 cut(s) 93, 126
BcoDI GTCTC 1 cut(s) 161
BfaI CTAG 1 cut(s) 164
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 1 cut(s) 6
BpmI CTGGAG 1 cut(s) 57
BsaWI WCCGGW 1 cut(s) 225
Bsc4I CCNNNNNNNGG 1 cut(s) 86
Bse1I ACTGG 2 cut(s) 130, 183
BseGI GGATG 1 cut(s) 112
BseLI CCNNNNNNNGG 1 cut(s) 86
BseMII CTCAG 1 cut(s) 95
BseNI ACTGG 2 cut(s) 130, 183
BsiSI CCGG 1 cut(s) 226
BslFI GGGAC 1 cut(s) 31
BslI CCNNNNNNNGG 1 cut(s) 86
BsmAI GTCTC 1 cut(s) 161
BsmBI CGTCTC 1 cut(s) 161
BsmFI GGGAC 1 cut(s) 31
Bsp143I GATC 1 cut(s) 22
BspCNI CTCAG 1 cut(s) 94
BspLI GGNNCC 1 cut(s) 6
BsrI ACTGG 2 cut(s) 130, 183
BssMI GATC 1 cut(s) 22
Bst4CI ACNGT 1 cut(s) 13
BstDEI CTNAG 2 cut(s) 30, 81
BstF5I GGATG 1 cut(s) 112
BstKTI GATC 1 cut(s) 25
BstMAI GTCTC 1 cut(s) 161
BstMBI GATC 1 cut(s) 22
BstNSI RCATGY 1 cut(s) 209
BtsCI GGATG 1 cut(s) 112
Cfr13I GGNCC 1 cut(s) 4
CviAII CATG 1 cut(s) 206
CviJI RGCY 1 cut(s) 71
CviKI_1 RGCY 1 cut(s) 71
DdeI CTNAG 2 cut(s) 30, 81
DpnI GATC 1 cut(s) 24
DpnII GATC 1 cut(s) 22
Eco47I GGWCC 1 cut(s) 4
Esp3I CGTCTC 1 cut(s) 161
FaeI CATG 1 cut(s) 209
FaiI YATR 2 cut(s) 180, 207
FaqI GGGAC 1 cut(s) 31
FatI CATG 1 cut(s) 205
FokI GGATG 1 cut(s) 119
FspBI CTAG 1 cut(s) 164
GsuI CTGGAG 1 cut(s) 57
HapII CCGG 1 cut(s) 226
Hin1II CATG 1 cut(s) 209
HinfI GANTC 5 cut(s) 44, 59, 95, 148, 211
HpaII CCGG 1 cut(s) 226
HphI GGTGA 1 cut(s) 140
Hpy166II GTNNAC 1 cut(s) 131
Hpy188I TCNGA 4 cut(s) 22, 84, 160, 216
Hpy188III TCNNGA 1 cut(s) 56
Hpy8I GTNNAC 1 cut(s) 131
HpyAV CCTTC 1 cut(s) 211
HpyCH4III ACNGT 1 cut(s) 13
HpyF3I CTNAG 2 cut(s) 30, 81
Hsp92II CATG 1 cut(s) 209
Kzo9I GATC 1 cut(s) 22
LmnI GCTCC 1 cut(s) 76
LpnPI CCDG 4 cut(s) 69, 87, 111, 196
MaeI CTAG 1 cut(s) 164
MalI GATC 1 cut(s) 24
MboI GATC 1 cut(s) 22
MboII GAAGA 1 cut(s) 104
MluCI AATT 3 cut(s) 137, 154, 173
MlyI GAGTC 3 cut(s) 53, 142, 205
MnlI CCTC 1 cut(s) 90
MspI CCGG 1 cut(s) 226
NdeII GATC 1 cut(s) 22
NlaIII CATG 1 cut(s) 209
NlaIV GGNNCC 1 cut(s) 6
NspI RCATGY 1 cut(s) 209
PfeI GAWTC 2 cut(s) 59, 95
PleI GAGTC 3 cut(s) 52, 142, 205
PpsI GAGTC 3 cut(s) 52, 142, 205
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 4
Sau3AI GATC 1 cut(s) 22
Sau96I GGNCC 1 cut(s) 4
SchI GAGTC 3 cut(s) 53, 142, 205
SetI ASST 4 cut(s) 73, 82, 136, 165
SgeI CNNG 8 cut(s) 55, 68, 80, 86, 138, 176, 195, 218
SinI GGWCC 1 cut(s) 4
Sse9I AATT 3 cut(s) 137, 154, 173
SspMI CTAG 1 cut(s) 164
TaaI ACNGT 1 cut(s) 13
TaqI TCGA 1 cut(s) 42
TasI AATT 3 cut(s) 137, 154, 173
TfiI GAWTC 2 cut(s) 59, 95
TspDTI ATGAA 1 cut(s) 6
TspGWI ACGGA 1 cut(s) 119
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 2 cut(s) 154, 173
XceI RCATGY 1 cut(s) 209
XspI CTAG 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.