Rh5AG244700

B3 DNA binding domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
29880258 .. 30044714
164457 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG244700.1

Sequence Viewer

Length: 330 bp
ATGACAAGGGCTGAGCAACTCCAAAAAGTCTCTGGAAACTTAAACTCTGATCTTGTACCTCGGTTTGAGAAGTCATCAACCGTAAGTGATACTAATCACAGTACAGAATTTCTTGTGATACTGAAGAAATATGCAGAGGAACAATCTCCAAGGGACATTGAAACAAGTCCAACACCTGTAGATACAAGTCTGAAAACAGACCAGGAACAAAGTCCAACGCCTGCAGATACAAGTGTGAAAACAGACCAGGGACAATCTCCAAGGGATATGGAGACAAGTCCAACTTTTGTAGAAGCAAGTCAGAAATCAGACAAGGTAATTAGTAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

109

Amino Acids

12.05

Weight (kDa)

4.69

Isoelectric Point (pI)

59.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 107
AcuI CTGAAG 1 cut(s) 143
AfaI GTAC 2 cut(s) 57, 103
AgsI TTSAA 1 cut(s) 161
AjnI CCWGG 2 cut(s) 201, 246
Alw26I GTCTC 2 cut(s) 34, 266
ApoI RAATTY 1 cut(s) 107
BaeI ACNNNNGTAYC 2 cut(s) 219, 252
BciT130I CCWGG 2 cut(s) 203, 248
BcoDI GTCTC 2 cut(s) 34, 266
BfmI CTRYAG 2 cut(s) 177, 222
BlpI GCTNAGC 1 cut(s) 12
Bme1390I CCNGG 2 cut(s) 203, 248
BmrFI CCNGG 2 cut(s) 203, 248
Bpu1102I GCTNAGC 1 cut(s) 12
BsaBI GATNNNNATC 1 cut(s) 93
BsaJI CCNNGG 4 cut(s) 59, 149, 247, 260
Bse8I GATNNNNATC 1 cut(s) 93
BseBI CCWGG 2 cut(s) 203, 248
BseDI CCNNGG 4 cut(s) 59, 149, 247, 260
BseJI GATNNNNATC 1 cut(s) 93
BslFI GGGAC 2 cut(s) 167, 264
BsmAI GTCTC 2 cut(s) 34, 266
BsmFI GGGAC 2 cut(s) 167, 264
Bsp143I GATC 1 cut(s) 49
Bsp1720I GCTNAGC 1 cut(s) 12
BspCNI CTCAG 1 cut(s) 4
BspMAI CTGCAG 1 cut(s) 226
BssECI CCNNGG 4 cut(s) 59, 149, 247, 260
BssMI GATC 1 cut(s) 49
BssT1I CCWWGG 2 cut(s) 149, 260
Bst2UI CCWGG 2 cut(s) 203, 248
Bst4CI ACNGT 2 cut(s) 82, 101
BstC8I GCNNGC 1 cut(s) 222
BstDEI CTNAG 1 cut(s) 12
BstKTI GATC 1 cut(s) 52
BstMAI GTCTC 2 cut(s) 34, 266
BstMBI GATC 1 cut(s) 49
BstNI CCWGG 2 cut(s) 203, 248
BstSCI CCNGG 2 cut(s) 201, 246
BstSFI CTRYAG 2 cut(s) 177, 222
Cac8I GCNNGC 1 cut(s) 222
Csp6I GTAC 2 cut(s) 56, 102
CviJI RGCY 1 cut(s) 11
CviKI_1 RGCY 1 cut(s) 11
CviQI GTAC 2 cut(s) 56, 102
DdeI CTNAG 1 cut(s) 12
DpnI GATC 1 cut(s) 51
DpnII GATC 1 cut(s) 49
Eco130I CCWWGG 2 cut(s) 149, 260
Eco57I CTGAAG 1 cut(s) 143
EcoRII CCWGG 2 cut(s) 201, 246
EcoT14I CCWWGG 2 cut(s) 149, 260
ErhI CCWWGG 2 cut(s) 149, 260
FaiI YATR 2 cut(s) 132, 269
FalI AAGNNNNNCTT 2 cut(s) 268, 300
FaqI GGGAC 2 cut(s) 167, 264
Hpy188I TCNGA 4 cut(s) 49, 192, 303, 310
Hpy188III TCNNGA 1 cut(s) 33
HpyCH4III ACNGT 2 cut(s) 82, 101
HpyCH4V TGCA 2 cut(s) 134, 224
HpyF3I CTNAG 1 cut(s) 12
Kzo9I GATC 1 cut(s) 49
LpnPI CCDG 7 cut(s) 18, 188, 189, 215, 233, 234, 260
MalI GATC 1 cut(s) 51
MboI GATC 1 cut(s) 49
MboII GAAGA 1 cut(s) 136
MluCI AATT 3 cut(s) 107, 318, 325
MmeI TCCRAC 3 cut(s) 194, 239, 305
MnlI CCTC 2 cut(s) 69, 130
MseI TTAA 1 cut(s) 41
MspR9I CCNGG 2 cut(s) 203, 248
MvaI CCWGG 2 cut(s) 203, 248
NdeII GATC 1 cut(s) 49
Psp6I CCWGG 2 cut(s) 201, 246
PspGI CCWGG 2 cut(s) 201, 246
PstI CTGCAG 1 cut(s) 226
RsaI GTAC 2 cut(s) 57, 103
RsaNI GTAC 2 cut(s) 56, 102
SaqAI TTAA 1 cut(s) 41
Sau3AI GATC 1 cut(s) 49
ScrFI CCNGG 2 cut(s) 203, 248
SetI ASST 3 cut(s) 61, 178, 318
SfcI CTRYAG 2 cut(s) 177, 222
Sse9I AATT 3 cut(s) 107, 318, 325
StyD4I CCNGG 2 cut(s) 201, 246
StyI CCWWGG 2 cut(s) 149, 260
TaaI ACNGT 2 cut(s) 82, 101
TasI AATT 3 cut(s) 107, 318, 325
TatI WGTACW 1 cut(s) 101
Tru1I TTAA 1 cut(s) 41
Tru9I TTAA 1 cut(s) 41
XapI RAATTY 1 cut(s) 107
XcmI CCANNNNNNNNNTGG 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.