Rmu_co8146880.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8146880.1
OG0001442
Physical Location & Seq
Reverse (-)
1 .. 378
378 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8146880.1_g000001.1.cds

Sequence Viewer

Length: 327 bp
atgagctgttcaaacttacgtgatcttggtacgttggttactggaaatcctggcttcattgactacagagtggctcctctgtcaaaatttgggaactactcatgtcaaaacacaagtggaggaccaaggataactcttaggtgcaatagttgtcaaccaattcaagacaatatgtatatttgctggcagttcattgatcttcctgataatcctgctgctgctgttggatttcagttcaatcttactgcaaggagtcatgctaataaaagacatctgagttttgttagtggaaccctaaagaatggaagtactttggatgatagacca
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

109

Amino Acids

11.99

Weight (kDa)

8.72

Isoelectric Point (pI)

38.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 86
AfaI GTAC 2 cut(s) 31, 310
AgsI TTSAA 3 cut(s) 12, 164, 238
AjnI CCWGG 1 cut(s) 49
AluBI AGCT 1 cut(s) 6
AluI AGCT 1 cut(s) 6
ApeKI GCWGC 2 cut(s) 215, 218
ApoI RAATTY 1 cut(s) 86
AspS9I GGNCC 1 cut(s) 122
AvaII GGWCC 1 cut(s) 122
BaeI ACNNNNGTAYC 2 cut(s) 21, 54
BbvI GCAGC 2 cut(s) 202, 205
BciT130I CCWGG 1 cut(s) 51
BfmI CTRYAG 1 cut(s) 64
BisI GCNGC 2 cut(s) 216, 219
BlsI GCNGC 2 cut(s) 217, 220
BmcAI AGTACT 1 cut(s) 310
Bme1390I CCNGG 1 cut(s) 51
Bme18I GGWCC 1 cut(s) 122
BmgT120I GGNCC 1 cut(s) 122
BmiI GGNNCC 2 cut(s) 75, 292
BmrFI CCNGG 1 cut(s) 51
BsaAI YACGTR 1 cut(s) 20
BsaJI CCNNGG 1 cut(s) 125
Bse1I ACTGG 1 cut(s) 46
BseBI CCWGG 1 cut(s) 51
BseDI CCNNGG 1 cut(s) 125
BseGI GGATG 1 cut(s) 322
BseMII CTCAG 1 cut(s) 266
BseNI ACTGG 1 cut(s) 46
BseRI GAGGAG 1 cut(s) 66
BseXI GCAGC 2 cut(s) 202, 205
Bsp143I GATC 2 cut(s) 22, 196
BspCNI CTCAG 1 cut(s) 267
BspLI GGNNCC 2 cut(s) 75, 292
BsrI ACTGG 1 cut(s) 46
BssECI CCNNGG 1 cut(s) 125
BssMI GATC 2 cut(s) 22, 196
BssT1I CCWWGG 1 cut(s) 125
Bst2UI CCWGG 1 cut(s) 51
BstBAI YACGTR 1 cut(s) 20
BstC8I GCNNGC 1 cut(s) 185
BstDEI CTNAG 2 cut(s) 137, 275
BstF5I GGATG 1 cut(s) 322
BstKTI GATC 2 cut(s) 25, 199
BstMBI GATC 2 cut(s) 22, 196
BstNI CCWGG 1 cut(s) 51
BstSCI CCNGG 1 cut(s) 49
BstSFI CTRYAG 1 cut(s) 64
BstV1I GCAGC 2 cut(s) 202, 205
BtsCI GGATG 1 cut(s) 322
Cac8I GCNNGC 1 cut(s) 185
Cfr13I GGNCC 1 cut(s) 122
Csp6I GTAC 2 cut(s) 30, 309
CviAII CATG 2 cut(s) 102, 257
CviJI RGCY 3 cut(s) 6, 54, 74
CviKI_1 RGCY 3 cut(s) 6, 54, 74
CviQI GTAC 2 cut(s) 30, 309
DdeI CTNAG 2 cut(s) 137, 275
DpnI GATC 2 cut(s) 24, 198
DpnII GATC 2 cut(s) 22, 196
Eco130I CCWWGG 1 cut(s) 125
Eco47I GGWCC 1 cut(s) 122
EcoRII CCWGG 1 cut(s) 49
EcoT14I CCWWGG 1 cut(s) 125
ErhI CCWWGG 1 cut(s) 125
FaeI CATG 2 cut(s) 105, 260
FaiI YATR 4 cut(s) 103, 173, 177, 258
FatI CATG 2 cut(s) 101, 256
Fnu4HI GCNGC 2 cut(s) 216, 219
Fsp4HI GCNGC 2 cut(s) 216, 219
GluI GCNGC 2 cut(s) 216, 219
Hin1II CATG 2 cut(s) 105, 260
HincII GTYRAC 1 cut(s) 155
HindII GTYRAC 1 cut(s) 155
HinfI GANTC 1 cut(s) 253
Hpy166II GTNNAC 1 cut(s) 155
Hpy188I TCNGA 1 cut(s) 276
Hpy188III TCNNGA 2 cut(s) 164, 203
Hpy8I GTNNAC 1 cut(s) 155
HpyCH4IV ACGT 2 cut(s) 19, 32
HpyCH4V TGCA 2 cut(s) 144, 248
HpyF3I CTNAG 2 cut(s) 137, 275
HpySE526I ACGT 2 cut(s) 19, 32
Hsp92II CATG 2 cut(s) 105, 260
Kzo9I GATC 2 cut(s) 22, 196
LmnI GCTCC 1 cut(s) 79
LpnPI CCDG 6 cut(s) 27, 36, 63, 169, 216, 225
Lsp1109I GCAGC 2 cut(s) 202, 205
MaeII ACGT 2 cut(s) 19, 32
MaeIII GTNAC 1 cut(s) 37
MalI GATC 2 cut(s) 24, 198
MboI GATC 2 cut(s) 22, 196
MboII GAAGA 1 cut(s) 191
MluCI AATT 2 cut(s) 86, 159
MlyI GAGTC 1 cut(s) 262
MmeI TCCRAC 1 cut(s) 205
MnlI CCTC 2 cut(s) 87, 113
MspR9I CCNGG 1 cut(s) 51
MvaI CCWGG 1 cut(s) 51
NdeII GATC 2 cut(s) 22, 196
NlaIII CATG 2 cut(s) 105, 260
NlaIV GGNNCC 2 cut(s) 75, 292
PkrI GCNGC 2 cut(s) 217, 220
PleI GAGTC 1 cut(s) 261
PpsI GAGTC 1 cut(s) 261
Ppu21I YACGTR 1 cut(s) 20
Psp6I CCWGG 1 cut(s) 49
PspGI CCWGG 1 cut(s) 49
PspN4I GGNNCC 2 cut(s) 75, 292
PspPI GGNCC 1 cut(s) 122
RsaI GTAC 2 cut(s) 31, 310
RsaNI GTAC 2 cut(s) 30, 309
SatI GCNGC 2 cut(s) 216, 219
Sau3AI GATC 2 cut(s) 22, 196
Sau96I GGNCC 1 cut(s) 122
ScaI AGTACT 1 cut(s) 310
SchI GAGTC 1 cut(s) 262
ScrFI CCNGG 1 cut(s) 51
SetI ASST 4 cut(s) 8, 22, 35, 143
SfcI CTRYAG 1 cut(s) 64
SinI GGWCC 1 cut(s) 122
Sse9I AATT 2 cut(s) 86, 159
StyD4I CCNGG 1 cut(s) 49
StyI CCWWGG 1 cut(s) 125
TaiI ACGT 2 cut(s) 22, 35
TasI AATT 2 cut(s) 86, 159
TatI WGTACW 1 cut(s) 308
TseI GCWGC 2 cut(s) 215, 218
TspDTI ATGAA 2 cut(s) 46, 181
VpaK11BI GGWCC 1 cut(s) 122
XapI RAATTY 1 cut(s) 86
ZrmI AGTACT 1 cut(s) 310
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.