Rmu_co8443701.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8443701.1
Physical Location & Seq
Forward (+)
1 .. 1138
1138 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8443701.1_g000001.1.cds

Sequence Viewer

Length: 801 bp
gatgatcaaaagatggttaagaaacggaaaacagaacttggtggaatgttttcaacagcaagctggatactctttattggtttgtttgctgcgttgctctaccaaatcataactaagagaagtatcgaggtacataatgtcagagcatcaaatgcacctgatttggccttgttcaacaatgacctggaatttaacataaccactatttctagtatgagctgttcaaacttacgtgatcttggtactttggtcactggaaatcctggcttcatcgactacagagtggttcctctgtcaaaatttgggaactactcatgtcaaaatacaagtggaggaccaaggataactcttaggtgcaataattgtcaaccaattcaagacaatatgtacatttcctggcagttcactgatcttcctgataatcctgctgctgctgttggatttcagttcaatcttactacaaggagccatgctaataaaagacatctgagttttgttagtggaaccctgaagaatgcaagtactttggatgatagaccagttacattcagagggattaatacaaatatattgaaattcagtttatttccgcggatataccgtaatctacatgatctaaggctcatccaacctttgtttcatgcgtttgtaccgggttcattctttaatgacacaagtcagctccaagcatcccttcaaagtccgaaggatggaaaacttaacactacattgtacatcaacttcctctctgactacattgtggagatagataagcaaaatattatgggtcctggtaagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

266

Amino Acids

29.91

Weight (kDa)

9.3

Isoelectric Point (pI)

42.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 592
AciI CCGC 2 cut(s) 590, 592
AcsI RAATTY 3 cut(s) 188, 299, 575
AcuI CTGAAG 1 cut(s) 530
AfaI GTAC 6 cut(s) 132, 244, 389, 523, 651, 734
AfiI CCNNNNNNNGG 1 cut(s) 710
AgsI TTSAA 7 cut(s) 54, 175, 225, 377, 451, 574, 698
AjnI CCWGG 4 cut(s) 183, 262, 395, 790
AjuI GAANNNNNNNTTGG 4 cut(s) 621, 653, 678, 710
AluBI AGCT 3 cut(s) 63, 219, 682
AluI AGCT 3 cut(s) 63, 219, 682
AoxI GGCC 1 cut(s) 165
ApeKI GCWGC 3 cut(s) 89, 428, 431
ApoI RAATTY 3 cut(s) 188, 299, 575
AseI ATTAAT 1 cut(s) 558
Asp700I GAANNNNTTC 1 cut(s) 49
AspS9I GGNCC 2 cut(s) 335, 788
AsuC2I CCSGG 1 cut(s) 654
AvaII GGWCC 2 cut(s) 335, 788
BaeI ACNNNNGTAYC 2 cut(s) 234, 267
BarI GAAGNNNNNNTAC 2 cut(s) 725, 757
BbvI GCAGC 3 cut(s) 76, 415, 418
BccI CCATC 2 cut(s) 7, 704
BciT130I CCWGG 4 cut(s) 185, 264, 397, 792
BciVI GTATCC 1 cut(s) 60
BclI TGATCA 1 cut(s) 4
BcnI CCSGG 1 cut(s) 654
BfaI CTAG 1 cut(s) 210
BfmI CTRYAG 1 cut(s) 277
BfuI GTATCC 1 cut(s) 60
BisI GCNGC 3 cut(s) 90, 429, 432
BlsI GCNGC 3 cut(s) 91, 430, 433
BmcAI AGTACT 1 cut(s) 523
Bme1390I CCNGG 5 cut(s) 185, 264, 397, 654, 792
Bme18I GGWCC 2 cut(s) 335, 788
BmgT120I GGNCC 2 cut(s) 335, 788
BmiI GGNNCC 4 cut(s) 288, 467, 505, 789
BmrFI CCNGG 5 cut(s) 185, 264, 397, 654, 792
BmsI GCATC 2 cut(s) 155, 698
BoxI GACNNNNGTC 1 cut(s) 675
BpuMI CCSGG 1 cut(s) 654
BsaAI YACGTR 1 cut(s) 233
BsaJI CCNNGG 2 cut(s) 338, 590
Bsc4I CCNNNNNNNGG 1 cut(s) 710
Bse1I ACTGG 2 cut(s) 259, 539
BseBI CCWGG 4 cut(s) 185, 264, 397, 792
BseDI CCNNGG 2 cut(s) 338, 590
BseGI GGATG 4 cut(s) 535, 624, 689, 715
BseLI CCNNNNNNNGG 1 cut(s) 710
BseMII CTCAG 1 cut(s) 479
BseNI ACTGG 2 cut(s) 259, 539
BseXI GCAGC 3 cut(s) 76, 415, 418
Bsh1236I CGCG 1 cut(s) 592
BshFI GGCC 1 cut(s) 167
BsiSI CCGG 1 cut(s) 653
BslI CCNNNNNNNGG 1 cut(s) 710
BsmI GAATGC 1 cut(s) 520
BsnI GGCC 1 cut(s) 167
Bsp1407I TGTACA 2 cut(s) 387, 732
Bsp143I GATC 4 cut(s) 4, 235, 409, 613
BspACI CCGC 2 cut(s) 590, 592
BspANI GGCC 1 cut(s) 167
BspCNI CTCAG 1 cut(s) 480
BspFNI CGCG 1 cut(s) 592
BspLI GGNNCC 4 cut(s) 288, 467, 505, 789
BsrGI TGTACA 2 cut(s) 387, 732
BsrI ACTGG 2 cut(s) 259, 539
BssECI CCNNGG 2 cut(s) 338, 590
BssMI GATC 4 cut(s) 4, 235, 409, 613
BssT1I CCWWGG 1 cut(s) 338
Bst2UI CCWGG 4 cut(s) 185, 264, 397, 792
Bst4CI ACNGT 1 cut(s) 602
BstAPI GCANNNNNTGC 1 cut(s) 152
BstAUI TGTACA 2 cut(s) 387, 732
BstBAI YACGTR 1 cut(s) 233
BstC8I GCNNGC 1 cut(s) 61
BstDEI CTNAG 4 cut(s) 114, 350, 488, 617
BstDSI CCRYGG 1 cut(s) 590
BstF5I GGATG 4 cut(s) 535, 624, 689, 715
BstFNI CGCG 1 cut(s) 592
BstKTI GATC 4 cut(s) 7, 238, 412, 616
BstMBI GATC 4 cut(s) 4, 235, 409, 613
BstMWI GCNNNNNNNGC 1 cut(s) 152
BstNI CCWGG 4 cut(s) 185, 264, 397, 792
BstPAI GACNNNNGTC 1 cut(s) 675
BstSCI CCNGG 5 cut(s) 183, 262, 395, 652, 790
BstSFI CTRYAG 1 cut(s) 277
BstUI CGCG 1 cut(s) 592
BstV1I GCAGC 3 cut(s) 76, 415, 418
BsuI GTATCC 1 cut(s) 60
BsuRI GGCC 1 cut(s) 167
BtgI CCRYGG 1 cut(s) 590
BtsCI GGATG 4 cut(s) 535, 624, 689, 715
BtsIMutI CAGTG 2 cut(s) 252, 405
Cac8I GCNNGC 1 cut(s) 61
Cfr13I GGNCC 2 cut(s) 335, 788
Cfr42I CCGCGG 1 cut(s) 593
Csp6I GTAC 6 cut(s) 131, 243, 388, 522, 650, 733
CviAII CATG 4 cut(s) 315, 470, 611, 641
CviJI RGCY 7 cut(s) 63, 167, 219, 267, 468, 622, 682
CviKI_1 RGCY 7 cut(s) 63, 167, 219, 267, 468, 622, 682
CviQI GTAC 6 cut(s) 131, 243, 388, 522, 650, 733
DdeI CTNAG 4 cut(s) 114, 350, 488, 617
DpnI GATC 4 cut(s) 6, 237, 411, 615
DpnII GATC 4 cut(s) 4, 235, 409, 613
Eco130I CCWWGG 1 cut(s) 338
Eco47I GGWCC 2 cut(s) 335, 788
Eco57I CTGAAG 1 cut(s) 530
EcoO109I RGGNCCY 1 cut(s) 788
EcoRII CCWGG 4 cut(s) 183, 262, 395, 790
EcoT14I CCWWGG 1 cut(s) 338
ErhI CCWWGG 1 cut(s) 338
FaeI CATG 4 cut(s) 318, 473, 614, 644
FalI AAGNNNNNCTT 2 cut(s) 678, 710
FatI CATG 4 cut(s) 314, 469, 610, 640
FbaI TGATCA 1 cut(s) 4
Fnu4HI GCNGC 3 cut(s) 90, 429, 432
FokI GGATG 4 cut(s) 542, 611, 676, 722
Fsp4HI GCNGC 3 cut(s) 90, 429, 432
FspBI CTAG 1 cut(s) 210
GluI GCNGC 3 cut(s) 90, 429, 432
HaeIII GGCC 1 cut(s) 167
HapII CCGG 1 cut(s) 653
Hin1II CATG 4 cut(s) 318, 473, 614, 644
HincII GTYRAC 1 cut(s) 368
HindII GTYRAC 1 cut(s) 368
HpaII CCGG 1 cut(s) 653
Hpy166II GTNNAC 2 cut(s) 368, 405
Hpy188I TCNGA 5 cut(s) 143, 489, 551, 705, 751
Hpy188III TCNNGA 2 cut(s) 377, 416
Hpy8I GTNNAC 2 cut(s) 368, 405
HpyAV CCTTC 2 cut(s) 700, 704
HpyCH4III ACNGT 1 cut(s) 602
HpyCH4IV ACGT 1 cut(s) 232
HpyCH4V TGCA 3 cut(s) 155, 357, 518
HpyF10VI GCNNNNNNNGC 1 cut(s) 152
HpyF3I CTNAG 4 cut(s) 114, 350, 488, 617
HpySE526I ACGT 1 cut(s) 232
Hsp92II CATG 4 cut(s) 318, 473, 614, 644
Ksp22I TGATCA 1 cut(s) 4
KspI CCGCGG 1 cut(s) 593
Kzo9I GATC 4 cut(s) 4, 235, 409, 613
LmnI GCTCC 2 cut(s) 465, 687
Lsp1109I GCAGC 3 cut(s) 76, 415, 418
LweI GCATC 2 cut(s) 155, 698
MaeI CTAG 1 cut(s) 210
MaeII ACGT 1 cut(s) 232
MaeIII GTNAC 2 cut(s) 250, 541
MalI GATC 4 cut(s) 6, 237, 411, 615
MboI GATC 4 cut(s) 4, 235, 409, 613
MboII GAAGA 2 cut(s) 404, 523
MluCI AATT 5 cut(s) 188, 299, 361, 372, 575
MmeI TCCRAC 2 cut(s) 418, 652
MnlI CCTC 5 cut(s) 121, 300, 326, 545, 755
MroXI GAANNNNTTC 1 cut(s) 49
MseI TTAA 5 cut(s) 18, 192, 558, 666, 720
MspA1I CMGCKG 1 cut(s) 592
MspI CCGG 1 cut(s) 653
MspR9I CCNGG 5 cut(s) 185, 264, 397, 654, 792
Mva1269I GAATGC 1 cut(s) 520
MvaI CCWGG 4 cut(s) 185, 264, 397, 792
MvnI CGCG 1 cut(s) 592
MwoI GCNNNNNNNGC 1 cut(s) 152
NciI CCSGG 1 cut(s) 654
NdeII GATC 4 cut(s) 4, 235, 409, 613
NlaIII CATG 4 cut(s) 318, 473, 614, 644
NlaIV GGNNCC 4 cut(s) 288, 467, 505, 789
NmuCI GTSAC 1 cut(s) 250
PctI GAATGC 1 cut(s) 520
PdmI GAANNNNTTC 1 cut(s) 49
PkrI GCNGC 3 cut(s) 91, 430, 433
Ppu21I YACGTR 1 cut(s) 233
PpuMI RGGWCCY 1 cut(s) 788
PshAI GACNNNNGTC 1 cut(s) 675
PshBI ATTAAT 1 cut(s) 558
Psp5II RGGWCCY 1 cut(s) 788
Psp6I CCWGG 4 cut(s) 183, 262, 395, 790
PspGI CCWGG 4 cut(s) 183, 262, 395, 790
PspN4I GGNNCC 4 cut(s) 288, 467, 505, 789
PspPI GGNCC 2 cut(s) 335, 788
PspPPI RGGWCCY 1 cut(s) 788
PsrI GAACNNNNNNTAC 2 cut(s) 205, 237
RsaI GTAC 6 cut(s) 132, 244, 389, 523, 651, 734
RsaNI GTAC 6 cut(s) 131, 243, 388, 522, 650, 733
SacII CCGCGG 1 cut(s) 593
SaqAI TTAA 5 cut(s) 18, 192, 558, 666, 720
SatI GCNGC 3 cut(s) 90, 429, 432
Sau3AI GATC 4 cut(s) 4, 235, 409, 613
Sau96I GGNCC 2 cut(s) 335, 788
ScaI AGTACT 1 cut(s) 523
ScrFI CCNGG 5 cut(s) 185, 264, 397, 654, 792
SetI ASST 9 cut(s) 65, 132, 160, 186, 221, 235, 356, 634, 684
SfaNI GCATC 2 cut(s) 155, 698
SfcI CTRYAG 1 cut(s) 277
Sfr303I CCGCGG 1 cut(s) 593
SgrBI CCGCGG 1 cut(s) 593
SinI GGWCC 2 cut(s) 335, 788
Sse9I AATT 5 cut(s) 188, 299, 361, 372, 575
SsiI CCGC 2 cut(s) 590, 592
SspI AATATT 1 cut(s) 781
SspMI CTAG 1 cut(s) 210
StyD4I CCNGG 5 cut(s) 183, 262, 395, 652, 790
StyI CCWWGG 1 cut(s) 338
TaaI ACNGT 1 cut(s) 602
TaiI ACGT 1 cut(s) 235
TaqI TCGA 2 cut(s) 126, 273
TasI AATT 5 cut(s) 188, 299, 361, 372, 575
TatI WGTACW 3 cut(s) 387, 521, 732
Tru1I TTAA 5 cut(s) 18, 192, 558, 666, 720
Tru9I TTAA 5 cut(s) 18, 192, 558, 666, 720
TscAI CASTG 2 cut(s) 259, 412
TseFI GTSAC 1 cut(s) 250
TseI GCWGC 3 cut(s) 89, 428, 431
Tsp45I GTSAC 1 cut(s) 250
TspDTI ATGAA 3 cut(s) 259, 629, 648
TspGWI ACGGA 1 cut(s) 40
TspRI CASTG 2 cut(s) 259, 412
VpaK11BI GGWCC 2 cut(s) 335, 788
VspI ATTAAT 1 cut(s) 558
XapI RAATTY 3 cut(s) 188, 299, 575
XmnI GAANNNNTTC 1 cut(s) 49
XspI CTAG 1 cut(s) 210
ZrmI AGTACT 1 cut(s) 523
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.