Rmu_sc0013667.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013667.1
Physical Location & Seq
Forward (+)
108 .. 1758
1651 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013667.1_g000001.1.cds

Sequence Viewer

Length: 756 bp
atgcttgttcttacaggcctaccatcttccagctatgccctaggcatgaaattggcatgttatggtctaaagcaggcacaaatgattaaaaaactccggaatgaagatagtgtgctgcgcacgatcagaaatcggcggaaagctcaagaccattgggataaattgaggaaatatgtgatgtacacatggaactgcaaagcattggatgaatgttatgagagcacaaacaacagatcattttgcactgttttcagtacacaaccagtactccgaagtgggacatcacagaagcgaatgcaacatgaagcagataccattagttttaacaggaaactcagcttaaataacaagaagactgtcgttcaagagtgcttggacactgatggggatgtggaattttatacatcgagaactagagtgaaccctccggaaagttcatcaaattctggagctggagttggacctcatctgcaaagtgaattacttgcctctacaagggatggaaaacagcaaggtgttgcttcgtgcgagcaagattcgtacctgcctaaagcatcatctctcacaaatgatgatatcattcctccacccccttcacttgaactgaaggaccctgctgaaatggatatgtctgatgttcagaagaatcttaaaagtttgtacgagtacaatgcgatgcttagggaaaaactagtagaggctcagtctttgttccattctttagctacaaactcttcaacagaagtccaaacatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

251

Amino Acids

28.25

Weight (kDa)

8.14

Isoelectric Point (pI)

56.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 119
Acc36I ACCTGC 1 cut(s) 552
AccIII TCCGGA 2 cut(s) 96, 427
AciI CCGC 1 cut(s) 136
AcsI RAATTY 2 cut(s) 395, 442
AcuI CTGAAG 1 cut(s) 626
AfaI GTAC 6 cut(s) 182, 256, 267, 542, 662, 668
AfiI CCNNNNNNNGG 1 cut(s) 495
AgsI TTSAA 3 cut(s) 365, 602, 738
AhlI ACTAGT 1 cut(s) 691
AluBI AGCT 5 cut(s) 33, 143, 339, 452, 725
AluI AGCT 5 cut(s) 33, 143, 339, 452, 725
Alw21I GWGCWC 1 cut(s) 224
Aor13HI TCCGGA 2 cut(s) 96, 427
AoxI GGCC 1 cut(s) 16
ApeKI GCWGC 1 cut(s) 115
ApoI RAATTY 2 cut(s) 395, 442
AspA2I CCTAGG 1 cut(s) 40
AspLEI GCGC 1 cut(s) 120
AspS9I GGNCC 2 cut(s) 461, 610
AvaII GGWCC 2 cut(s) 461, 610
AvrII CCTAGG 1 cut(s) 40
BbsI GAAGAC 1 cut(s) 359
Bbv12I GWGCWC 1 cut(s) 224
BbvI GCAGC 1 cut(s) 102
BccI CCATC 3 cut(s) 31, 377, 494
BcgI CGANNNNNNTGC 2 cut(s) 653, 687
BcuI ACTAGT 1 cut(s) 691
BfaI CTAG 3 cut(s) 41, 414, 692
BfuAI ACCTGC 1 cut(s) 552
BisI GCNGC 1 cut(s) 116
BlnI CCTAGG 1 cut(s) 40
BlsI GCNGC 1 cut(s) 117
BmcAI AGTACT 1 cut(s) 267
Bme18I GGWCC 2 cut(s) 461, 610
BmgT120I GGNCC 2 cut(s) 461, 610
BmiI GGNNCC 1 cut(s) 612
BmsI GCATC 2 cut(s) 563, 666
BpiI GAAGAC 1 cut(s) 359
BpmI CTGGAG 2 cut(s) 468, 474
Bpu10I CCTNAGC 1 cut(s) 680
BpuEI CTTGAG 1 cut(s) 129
BsaJI CCNNGG 1 cut(s) 40
BsaWI WCCGGW 2 cut(s) 96, 427
BsaXI ACNNNNNCTCC 4 cut(s) 252, 282, 441, 471
Bsc4I CCNNNNNNNGG 1 cut(s) 495
Bse1I ACTGG 1 cut(s) 263
BseAI TCCGGA 2 cut(s) 96, 427
BseDI CCNNGG 1 cut(s) 40
BseGI GGATG 3 cut(s) 211, 394, 505
BseLI CCNNNNNNNGG 1 cut(s) 495
BseMII CTCAG 2 cut(s) 349, 716
BseNI ACTGG 1 cut(s) 263
BseXI GCAGC 1 cut(s) 102
BshFI GGCC 1 cut(s) 18
BsiHKAI GWGCWC 1 cut(s) 224
BsiSI CCGG 2 cut(s) 97, 428
BslFI GGGAC 1 cut(s) 292
BslI CCNNNNNNNGG 1 cut(s) 495
BsmFI GGGAC 1 cut(s) 292
BsmI GAATGC 1 cut(s) 300
BsnI GGCC 1 cut(s) 18
Bsp1286I GDGCHC 1 cut(s) 224
Bsp13I TCCGGA 2 cut(s) 96, 427
Bsp1407I TGTACA 1 cut(s) 180
Bsp143I GATC 2 cut(s) 123, 233
BspACI CCGC 1 cut(s) 136
BspANI GGCC 1 cut(s) 18
BspCNI CTCAG 2 cut(s) 348, 715
BspEI TCCGGA 2 cut(s) 96, 427
BspLI GGNNCC 1 cut(s) 612
BspMI ACCTGC 1 cut(s) 552
BsrGI TGTACA 1 cut(s) 180
BsrI ACTGG 1 cut(s) 263
BssECI CCNNGG 1 cut(s) 40
BssMI GATC 2 cut(s) 123, 233
BssT1I CCWWGG 1 cut(s) 40
Bst4CI ACNGT 2 cut(s) 247, 358
Bst6I CTCTTC 1 cut(s) 739
BstAUI TGTACA 1 cut(s) 180
BstC8I GCNNGC 2 cut(s) 75, 530
BstDEI CTNAG 3 cut(s) 335, 680, 702
BstENI CCTNNNNNAGG 1 cut(s) 493
BstF5I GGATG 3 cut(s) 211, 394, 505
BstHHI GCGC 1 cut(s) 120
BstKTI GATC 2 cut(s) 126, 236
BstMBI GATC 2 cut(s) 123, 233
BstNSI RCATGY 1 cut(s) 60
BstV1I GCAGC 1 cut(s) 102
BstV2I GAAGAC 1 cut(s) 359
BsuRI GGCC 1 cut(s) 18
BtgZI GCGATG 1 cut(s) 689
BtsCI GGATG 3 cut(s) 211, 394, 505
BtsIMutI CAGTG 2 cut(s) 243, 378
BveI ACCTGC 1 cut(s) 552
Cac8I GCNNGC 2 cut(s) 75, 530
CfoI GCGC 1 cut(s) 120
Cfr13I GGNCC 2 cut(s) 461, 610
Csp6I GTAC 6 cut(s) 181, 255, 266, 541, 661, 667
CviAII CATG 4 cut(s) 46, 57, 186, 302
CviJI RGCY 7 cut(s) 18, 33, 143, 339, 452, 701, 725
CviKI_1 RGCY 7 cut(s) 18, 33, 143, 339, 452, 701, 725
CviQI GTAC 6 cut(s) 181, 255, 266, 541, 661, 667
DdeI CTNAG 3 cut(s) 335, 680, 702
DpnI GATC 2 cut(s) 125, 235
DpnII GATC 2 cut(s) 123, 233
Eam1104I CTCTTC 1 cut(s) 739
EarI CTCTTC 1 cut(s) 739
EciI GGCGGA 1 cut(s) 151
Eco130I CCWWGG 1 cut(s) 40
Eco147I AGGCCT 1 cut(s) 18
Eco32I GATATC 1 cut(s) 577
Eco47I GGWCC 2 cut(s) 461, 610
Eco57I CTGAAG 1 cut(s) 626
EcoNI CCTNNNNNAGG 1 cut(s) 493
EcoO109I RGGNCCY 1 cut(s) 610
EcoRV GATATC 1 cut(s) 577
EcoT14I CCWWGG 1 cut(s) 40
ErhI CCWWGG 1 cut(s) 40
FaeI CATG 4 cut(s) 49, 60, 189, 305
FaqI GGGAC 1 cut(s) 292
FatI CATG 4 cut(s) 45, 56, 185, 301
Fnu4HI GCNGC 1 cut(s) 116
FokI GGATG 3 cut(s) 218, 401, 512
Fsp4HI GCNGC 1 cut(s) 116
FspBI CTAG 3 cut(s) 41, 414, 692
FspI TGCGCA 1 cut(s) 119
GlaI GCGC 1 cut(s) 119
GluI GCNGC 1 cut(s) 116
GsuI CTGGAG 2 cut(s) 468, 474
HaeIII GGCC 1 cut(s) 18
HapII CCGG 2 cut(s) 97, 428
HhaI GCGC 1 cut(s) 120
Hin1II CATG 4 cut(s) 49, 60, 189, 305
Hin6I GCGC 1 cut(s) 118
HinP1I GCGC 1 cut(s) 118
HinfI GANTC 2 cut(s) 536, 646
HpaII CCGG 2 cut(s) 97, 428
Hpy166II GTNNAC 3 cut(s) 183, 257, 421
Hpy188I TCNGA 4 cut(s) 128, 272, 634, 642
Hpy188III TCNNGA 6 cut(s) 97, 146, 365, 408, 428, 447
Hpy8I GTNNAC 3 cut(s) 183, 257, 421
HpyAV CCTTC 2 cut(s) 601, 603
HpyCH4III ACNGT 2 cut(s) 247, 358
HpyCH4V TGCA 4 cut(s) 195, 243, 298, 472
HpyF3I CTNAG 3 cut(s) 335, 680, 702
Hsp92II CATG 4 cut(s) 49, 60, 189, 305
HspAI GCGC 1 cut(s) 118
Kpn2I TCCGGA 2 cut(s) 96, 427
Kzo9I GATC 2 cut(s) 123, 233
LmnI GCTCC 1 cut(s) 449
Lsp1109I GCAGC 1 cut(s) 102
LweI GCATC 2 cut(s) 563, 666
MaeI CTAG 3 cut(s) 41, 414, 692
MalI GATC 2 cut(s) 125, 235
MboI GATC 2 cut(s) 123, 233
MboII GAAGA 5 cut(s) 18, 116, 364, 655, 726
MhlI GDGCHC 1 cut(s) 224
MluCI AATT 5 cut(s) 50, 161, 395, 442, 479
MmeI TCCRAC 1 cut(s) 439
MnlI CCTC 6 cut(s) 159, 435, 474, 499, 594, 691
MroI TCCGGA 2 cut(s) 96, 427
MseI TTAA 4 cut(s) 87, 324, 341, 651
MspI CCGG 2 cut(s) 97, 428
Mva1269I GAATGC 1 cut(s) 300
NdeII GATC 2 cut(s) 123, 233
NlaIII CATG 4 cut(s) 49, 60, 189, 305
NlaIV GGNNCC 1 cut(s) 612
NsbI TGCGCA 1 cut(s) 119
NspI RCATGY 1 cut(s) 60
PceI AGGCCT 1 cut(s) 18
PctI GAATGC 1 cut(s) 300
PfeI GAWTC 2 cut(s) 536, 646
PkrI GCNGC 1 cut(s) 117
PpuMI RGGWCCY 1 cut(s) 610
Psp5II RGGWCCY 1 cut(s) 610
PspN4I GGNNCC 1 cut(s) 612
PspPI GGNCC 2 cut(s) 461, 610
PspPPI RGGWCCY 1 cut(s) 610
RsaI GTAC 6 cut(s) 182, 256, 267, 542, 662, 668
RsaNI GTAC 6 cut(s) 181, 255, 266, 541, 661, 667
SaqAI TTAA 4 cut(s) 87, 324, 341, 651
SatI GCNGC 1 cut(s) 116
Sau3AI GATC 2 cut(s) 123, 233
Sau96I GGNCC 2 cut(s) 461, 610
ScaI AGTACT 1 cut(s) 267
SduI GDGCHC 1 cut(s) 224
SetI ASST 8 cut(s) 35, 145, 341, 454, 466, 517, 546, 727
SfaNI GCATC 2 cut(s) 563, 666
SinI GGWCC 2 cut(s) 461, 610
SmlI CTYRAG 1 cut(s) 144
SmoI CTYRAG 1 cut(s) 144
SpeI ACTAGT 1 cut(s) 691
Sse9I AATT 5 cut(s) 50, 161, 395, 442, 479
SseBI AGGCCT 1 cut(s) 18
SsiI CCGC 1 cut(s) 136
SspMI CTAG 3 cut(s) 41, 414, 692
StuI AGGCCT 1 cut(s) 18
StyI CCWWGG 1 cut(s) 40
TaaI ACNGT 2 cut(s) 247, 358
TaqI TCGA 1 cut(s) 407
TasI AATT 5 cut(s) 50, 161, 395, 442, 479
TatI WGTACW 4 cut(s) 180, 254, 265, 666
TfiI GAWTC 2 cut(s) 536, 646
Tru1I TTAA 4 cut(s) 87, 324, 341, 651
Tru9I TTAA 4 cut(s) 87, 324, 341, 651
TscAI CASTG 2 cut(s) 250, 385
TseI GCWGC 1 cut(s) 115
TspDTI ATGAA 5 cut(s) 62, 117, 222, 318, 426
TspRI CASTG 2 cut(s) 250, 385
VpaK11BI GGWCC 2 cut(s) 461, 610
XagI CCTNNNNNAGG 1 cut(s) 493
XapI RAATTY 2 cut(s) 395, 442
XceI RCATGY 1 cut(s) 60
XmaJI CCTAGG 1 cut(s) 40
XspI CTAG 3 cut(s) 41, 414, 692
ZrmI AGTACT 1 cut(s) 267
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.