Rh3BG374300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Reverse (-)
47508764 .. 47509258
495 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG374300.1

Sequence Viewer

Length: 210 bp
ATGACACAAGTCAGCTCCAAGCATCCCTTCAAAGGCCTAAGGATGGAATACTTAACAGTTAACACCACATTGTACATCAACTTCCTCTCTGACTACATTGTGGAGATAGATAAGCAAAATATTATGGGTCCTGTGAGCTTCCTTGCTGATCTTGGCGGCTTGTATTGCATCTCCATTGGCATAATTTTCTACCTTCTGGTGCAAGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.84

Weight (kDa)

5.5

Isoelectric Point (pI)

24.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 156
AfaI GTAC 1 cut(s) 74
AfiI CCNNNNNNNGG 2 cut(s) 32, 43
AgsI TTSAA 1 cut(s) 31
AjuI GAANNNNNNNTTGG 2 cut(s) 11, 43
AluBI AGCT 2 cut(s) 15, 138
AluI AGCT 2 cut(s) 15, 138
AoxI GGCC 1 cut(s) 34
AspS9I GGNCC 1 cut(s) 128
AvaII GGWCC 1 cut(s) 128
AxyI CCTNAGG 1 cut(s) 38
BarI GAAGNNNNNNTAC 2 cut(s) 65, 97
BccI CCATC 1 cut(s) 37
BisI GCNGC 1 cut(s) 157
BlsI GCNGC 1 cut(s) 158
Bme18I GGWCC 1 cut(s) 128
BmgT120I GGNCC 1 cut(s) 128
BmiI GGNNCC 1 cut(s) 129
BmsI GCATC 2 cut(s) 31, 177
BoxI GACNNNNGTC 1 cut(s) 8
Bsc4I CCNNNNNNNGG 2 cut(s) 32, 43
Bse21I CCTNAGG 1 cut(s) 38
BseGI GGATG 2 cut(s) 22, 48
BseLI CCNNNNNNNGG 2 cut(s) 32, 43
BshFI GGCC 1 cut(s) 36
BslI CCNNNNNNNGG 2 cut(s) 32, 43
BsnI GGCC 1 cut(s) 36
Bsp1407I TGTACA 1 cut(s) 72
Bsp143I GATC 1 cut(s) 148
BspACI CCGC 1 cut(s) 156
BspANI GGCC 1 cut(s) 36
BspLI GGNNCC 1 cut(s) 129
BsrGI TGTACA 1 cut(s) 72
BssMI GATC 1 cut(s) 148
Bst4CI ACNGT 1 cut(s) 58
BstAUI TGTACA 1 cut(s) 72
BstDEI CTNAG 1 cut(s) 38
BstF5I GGATG 2 cut(s) 22, 48
BstKTI GATC 1 cut(s) 151
BstMBI GATC 1 cut(s) 148
BstMWI GCNNNNNNNGC 1 cut(s) 165
BstPAI GACNNNNGTC 1 cut(s) 8
Bsu36I CCTNAGG 1 cut(s) 38
BsuRI GGCC 1 cut(s) 36
BtsCI GGATG 2 cut(s) 22, 48
Cfr13I GGNCC 1 cut(s) 128
Csp6I GTAC 1 cut(s) 73
CviJI RGCY 4 cut(s) 15, 36, 138, 159
CviKI_1 RGCY 4 cut(s) 15, 36, 138, 159
CviQI GTAC 1 cut(s) 73
DdeI CTNAG 1 cut(s) 38
DpnI GATC 1 cut(s) 150
DpnII GATC 1 cut(s) 148
Eco147I AGGCCT 1 cut(s) 36
Eco47I GGWCC 1 cut(s) 128
Eco81I CCTNAGG 1 cut(s) 38
EcoO109I RGGNCCY 1 cut(s) 128
FaiI YATR 3 cut(s) 125, 182, 208
FalI AAGNNNNNCTT 2 cut(s) 11, 43
Fnu4HI GCNGC 1 cut(s) 157
FokI GGATG 2 cut(s) 9, 55
Fsp4HI GCNGC 1 cut(s) 157
GluI GCNGC 1 cut(s) 157
HaeIII GGCC 1 cut(s) 36
HincII GTYRAC 1 cut(s) 61
HindII GTYRAC 1 cut(s) 61
HpaI GTTAAC 1 cut(s) 61
Hpy166II GTNNAC 1 cut(s) 61
Hpy188I TCNGA 1 cut(s) 91
Hpy8I GTNNAC 1 cut(s) 61
HpyAV CCTTC 2 cut(s) 37, 203
HpyCH4III ACNGT 1 cut(s) 58
HpyCH4V TGCA 2 cut(s) 168, 202
HpyF10VI GCNNNNNNNGC 1 cut(s) 165
HpyF3I CTNAG 1 cut(s) 38
KspAI GTTAAC 1 cut(s) 61
Kzo9I GATC 1 cut(s) 148
LmnI GCTCC 1 cut(s) 20
LpnPI CCDG 2 cut(s) 144, 182
LweI GCATC 2 cut(s) 31, 177
MalI GATC 1 cut(s) 150
MboI GATC 1 cut(s) 148
MluCI AATT 1 cut(s) 183
MnlI CCTC 1 cut(s) 95
MseI TTAA 2 cut(s) 53, 60
MwoI GCNNNNNNNGC 1 cut(s) 165
NdeII GATC 1 cut(s) 148
NlaIV GGNNCC 1 cut(s) 129
PceI AGGCCT 1 cut(s) 36
PkrI GCNGC 1 cut(s) 158
PpuMI RGGWCCY 1 cut(s) 128
PshAI GACNNNNGTC 1 cut(s) 8
Psp5II RGGWCCY 1 cut(s) 128
PspN4I GGNNCC 1 cut(s) 129
PspPI GGNCC 1 cut(s) 128
PspPPI RGGWCCY 1 cut(s) 128
RsaI GTAC 1 cut(s) 74
RsaNI GTAC 1 cut(s) 73
SaqAI TTAA 2 cut(s) 53, 60
SatI GCNGC 1 cut(s) 157
Sau3AI GATC 1 cut(s) 148
Sau96I GGNCC 1 cut(s) 128
SetI ASST 3 cut(s) 17, 140, 195
SfaNI GCATC 2 cut(s) 31, 177
SgeI CNNG 6 cut(s) 20, 31, 143, 155, 164, 172
SinI GGWCC 1 cut(s) 128
Sse9I AATT 1 cut(s) 183
SseBI AGGCCT 1 cut(s) 36
SsiI CCGC 1 cut(s) 156
SspI AATATT 1 cut(s) 121
StuI AGGCCT 1 cut(s) 36
TaaI ACNGT 1 cut(s) 58
TasI AATT 1 cut(s) 183
TatI WGTACW 1 cut(s) 72
TauI GCSGC 1 cut(s) 159
Tru1I TTAA 2 cut(s) 53, 60
Tru9I TTAA 2 cut(s) 53, 60
VpaK11BI GGWCC 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.