Rmu_co8270263.1_g000001

Zinc finger, C3HC4 type (RING finger)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8270263.1
Physical Location & Seq
Forward (+)
84 .. 473
390 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8270263.1_g000001.1.cds

Sequence Viewer

Length: 390 bp
atggaagatcgatcttgcaccgtgaacacggttctatggaacacgattcagcttctatttccgcaagaagttgaagcaaggaaagcggctggagccttgagtagtcgtgaagaaggtgagcgggaaatccccgataaggcctttactagtagcaactcgaggaatcaaagcagaagagtatctggcagtgatgtggctgtaaggagaagcagggtagtattaagccaagatgatgatgaggacgagcctgcaccactagctataaggttacagatgagagaagctgagaatcaaaatcgagaactaggcagcttggctcgacggatatcatcaggcagagaaattaggcatataaagggtatcaagcagagatgcaagtcggacgagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

129

Amino Acids

14.62

Weight (kDa)

7.81

Isoelectric Point (pI)

73.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 121
AciI CCGC 3 cut(s) 62, 86, 121
AfiI CCNNNNNNNGG 1 cut(s) 136
AgsI TTSAA 1 cut(s) 74
AhlI ACTAGT 1 cut(s) 146
AluBI AGCT 4 cut(s) 52, 260, 284, 312
AluI AGCT 4 cut(s) 52, 260, 284, 312
Ama87I CYCGRG 1 cut(s) 157
AoxI GGCC 1 cut(s) 138
ApeKI GCWGC 1 cut(s) 309
AsuHPI GGTGA 1 cut(s) 128
AvaI CYCGRG 1 cut(s) 157
BbvI GCAGC 1 cut(s) 321
BcuI ACTAGT 1 cut(s) 146
BfaI CTAG 3 cut(s) 147, 257, 305
BisI GCNGC 2 cut(s) 87, 310
BlsI GCNGC 2 cut(s) 88, 311
BmeT110I CYCGRG 1 cut(s) 157
BmiI GGNNCC 1 cut(s) 94
BmsI GCATC 1 cut(s) 362
BpmI CTGGAG 1 cut(s) 111
BpuEI CTTGAG 1 cut(s) 118
Bsa29I ATCGAT 1 cut(s) 10
Bsc4I CCNNNNNNNGG 1 cut(s) 136
BseCI ATCGAT 1 cut(s) 10
BseLI CCNNNNNNNGG 1 cut(s) 136
BseMII CTCAG 1 cut(s) 276
BseXI GCAGC 1 cut(s) 321
BsgI GTGCAG 1 cut(s) 234
BshFI GGCC 1 cut(s) 140
BshVI ATCGAT 1 cut(s) 10
BsiHKCI CYCGRG 1 cut(s) 157
BslI CCNNNNNNNGG 1 cut(s) 136
BsnI GGCC 1 cut(s) 140
BsoBI CYCGRG 1 cut(s) 157
Bsp143I GATC 2 cut(s) 7, 11
BspACI CCGC 3 cut(s) 62, 86, 121
BspANI GGCC 1 cut(s) 140
BspCNI CTCAG 1 cut(s) 277
BspDI ATCGAT 1 cut(s) 10
BspLI GGNNCC 1 cut(s) 94
BsrBI CCGCTC 1 cut(s) 121
BssMI GATC 2 cut(s) 7, 11
Bst4CI ACNGT 2 cut(s) 22, 31
Bst6I CTCTTC 1 cut(s) 169
BstC8I GCNNGC 1 cut(s) 249
BstDEI CTNAG 1 cut(s) 285
BstKTI GATC 2 cut(s) 10, 14
BstMBI GATC 2 cut(s) 7, 11
BstMWI GCNNNNNNNGC 3 cut(s) 83, 92, 257
BstV1I GCAGC 1 cut(s) 321
Bsu15I ATCGAT 1 cut(s) 10
BsuRI GGCC 1 cut(s) 140
BsuTUI ATCGAT 1 cut(s) 10
BtsI GCAGTG 1 cut(s) 193
BtsIMutI CAGTG 1 cut(s) 193
Cac8I GCNNGC 1 cut(s) 249
ClaI ATCGAT 1 cut(s) 10
DdeI CTNAG 1 cut(s) 285
DpnI GATC 2 cut(s) 9, 13
DpnII GATC 2 cut(s) 7, 11
Eam1104I CTCTTC 1 cut(s) 169
EarI CTCTTC 1 cut(s) 169
Eco147I AGGCCT 1 cut(s) 140
Eco32I GATATC 1 cut(s) 327
Eco88I CYCGRG 1 cut(s) 157
EcoRV GATATC 1 cut(s) 327
FaiI YATR 4 cut(s) 37, 263, 351, 353
FauI CCCGC 1 cut(s) 114
Fnu4HI GCNGC 2 cut(s) 87, 310
Fsp4HI GCNGC 2 cut(s) 87, 310
FspBI CTAG 3 cut(s) 147, 257, 305
GluI GCNGC 2 cut(s) 87, 310
GsuI CTGGAG 1 cut(s) 111
HaeIII GGCC 1 cut(s) 140
HinfI GANTC 3 cut(s) 46, 163, 289
HphI GGTGA 1 cut(s) 128
Hpy166II GTNNAC 1 cut(s) 25
Hpy188I TCNGA 1 cut(s) 382
Hpy188III TCNNGA 2 cut(s) 107, 299
Hpy8I GTNNAC 1 cut(s) 25
Hpy99I CGWCG 1 cut(s) 324
HpyAV CCTTC 1 cut(s) 107
HpyCH4III ACNGT 2 cut(s) 22, 31
HpyCH4V TGCA 3 cut(s) 18, 251, 375
HpyF10VI GCNNNNNNNGC 3 cut(s) 83, 92, 257
HpyF3I CTNAG 1 cut(s) 285
Kzo9I GATC 2 cut(s) 7, 11
LmnI GCTCC 1 cut(s) 92
LpnPI CCDG 5 cut(s) 75, 168, 196, 261, 318
Lsp1109I GCAGC 1 cut(s) 321
LweI GCATC 1 cut(s) 362
MaeI CTAG 3 cut(s) 147, 257, 305
MaeIII GTNAC 1 cut(s) 267
MalI GATC 2 cut(s) 9, 13
MbiI CCGCTC 1 cut(s) 121
MboI GATC 2 cut(s) 7, 11
MboII GAAGA 3 cut(s) 17, 122, 186
MluCI AATT 1 cut(s) 342
MmeI TCCRAC 1 cut(s) 360
MnlI CCTC 2 cut(s) 153, 232
MseI TTAA 1 cut(s) 221
MwoI GCNNNNNNNGC 3 cut(s) 83, 92, 257
NdeII GATC 2 cut(s) 7, 11
NlaIV GGNNCC 1 cut(s) 94
PaeR7I CTCGAG 1 cut(s) 157
PceI AGGCCT 1 cut(s) 140
PfeI GAWTC 3 cut(s) 46, 163, 289
PkrI GCNGC 2 cut(s) 88, 311
PspN4I GGNNCC 1 cut(s) 94
PspXI VCTCGAGB 1 cut(s) 157
SaqAI TTAA 1 cut(s) 221
SatI GCNGC 2 cut(s) 87, 310
Sau3AI GATC 2 cut(s) 7, 11
SetI ASST 6 cut(s) 54, 118, 262, 269, 286, 314
SfaNI GCATC 1 cut(s) 362
Sfr274I CTCGAG 1 cut(s) 157
SlaI CTCGAG 1 cut(s) 157
SmlI CTYRAG 2 cut(s) 97, 157
SmoI CTYRAG 2 cut(s) 97, 157
SpeI ACTAGT 1 cut(s) 146
Sse9I AATT 1 cut(s) 342
SseBI AGGCCT 1 cut(s) 140
SsiI CCGC 3 cut(s) 62, 86, 121
SspMI CTAG 3 cut(s) 147, 257, 305
StuI AGGCCT 1 cut(s) 140
TaaI ACNGT 2 cut(s) 22, 31
TaqI TCGA 4 cut(s) 10, 158, 298, 319
TasI AATT 1 cut(s) 342
TauI GCSGC 1 cut(s) 89
TfiI GAWTC 3 cut(s) 46, 163, 289
Tru1I TTAA 1 cut(s) 221
Tru9I TTAA 1 cut(s) 221
TscAI CASTG 1 cut(s) 193
TseI GCWGC 1 cut(s) 309
TspGWI ACGGA 1 cut(s) 337
TspRI CASTG 1 cut(s) 193
XhoI CTCGAG 1 cut(s) 157
XspI CTAG 3 cut(s) 147, 257, 305
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.